Suggestions
Journal Information
Vol. 28. Issue 5.
(September - October 2024)
Cite
Cite
Share
Download PDF
More article options
Visits
5048
Vol. 28. Issue 5.
(September - October 2024)
Original Article
Full text access

Detection of Bartonella henselae DNA in Triatoma sordida collected in peridomiciliary environments

Visits
5048
Luciene Silva dos Santosa, Jader Oliveirab, Vagner José Mendonçac, João Aristeu Rosad, Alexandre Seiji Maekawae, Maurício Liliosof, Dayane Pires da Silvag, Carlos Eduardo Almeidah, Paulo Eduardo Neves Ferreira Velhoa,i,
Corresponding author
pvelho@unicamp.br

Corresponding author at: Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Rua Vital Brasil 50, Campinas, SP, Brazil.
, Marina Rovani Drummonda
a Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Campinas, SP, Brazil
b Universidade de São Paulo (USP), Faculdade de Saúde Pública, Laboratório de Entomologia em Saúde Pública, São Paulo, SP, Brasil
c Universidade Federal do Piauí, Departamento de Parasitologia e Microbiologia, Teresina, Piauí, Brasil
d Universidade Estadual Paulista (Unesp), Faculdade de Ciências Farmacêuticas, Laboratório de Parasitologia, Araraquara, SP, Brasil
e Faculty of Medicine – Endocrinology, Memorial University of Newfoundland, St. John's, Newfoundland and Labrador, Canada
f Universidade Estadual de Campinas (UNICAMP), Instituto de Biologia, Departamento de Biologia Animal - Parasitologia, Campinas, SP, Brasil
g Universidade de Campinas (UNICAMP), Instituto de Biologia, Programa de Pós-Graduação em Genética e Biologia Molecular, Campinas, SP, Brazil
h Universidade Federal do Rio de Janeiro (UFRJ), Instituto de Biologia, Laboratório de Entomologia, Rio de Janeiro, RJ, Brazil
i Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Departamento de Medicina, Divisão de Dermatologia, Campinas, SP, Brazil
Ver más
This item has received
Article information
Abstract
Full Text
Bibliography
Download PDF
Statistics
Figures (4)
fig0001
fig0002
fig0003
fig0004
Abstract

Bartonelloses represent a group of potentially fatal diseases associated with various clinical manifestations including endocarditis. Caused by bacteria belonging to the genus Bartonella, these microorganisms have a remarkable ability to infect mammals, and their transmission is commonly associated with hematophagous vectors such as fleas, lice, mosquitoes, and ticks. The aim of this study was to evaluate the occurrence of Bartonella sp. DNA in 81 triatomines of the species Triatoma sordida collected in the field in peri‑domiciliary areas of the Brazilian city of Seabra, located in the state of Bahia. Nested PCR was conducted targeting the ftsZ gene and real-time PCR targeting the gltA gene, both representing specific reactions for Bartonella henselae. Additionally, conventional PCR targeting kDNA was employed to evaluate the presence of Trypanosoma cruzi. Of the samples tested, 23/81 (28.39 %) bugs showed positive PCR for B. henselae. No sample showed positive PCR for T. cruzi. The high prevalence of triatomines with a positive PCR for B. henselae emphasizes the close relationship between these insects and the bacteria, indicating the need for further studies to investigate the vectorial potential of these kissing bugs.

Keywords:
Bartonella henselae
Chagas disease
Endocarditis
Trypanosoma cruzi
Full Text
Introduction

Among the zoonoses of interest in public health is Chagas Disease (CD), considered neglected by the World Health Organization (WHO). It is estimated that this disease affects around 6‒7 million people worldwide, and its underreporting emerges as a challenge since this disease has notable chances of cure when treated early.1 A study evaluating mortality caused by neglected diseases in Brazil between 2000‒2011 showed that CD was responsible for 76.7 % of all deaths.2

The agent of CD, Trypanosoma cruzi, is known to have several triatomines species associated with its transmission, in addition to demonstrating a wide variety of mammalian hosts. Among these hosts, many are carriers of other pathogens that also employ hematophagous arthropods as vectors.3–5

One such group of pathogens includes the genus Bartonella, comprising over 40 species of gram-negative bacteria.6 These bacteria are primarily transmitted by vectors like fleas, sandflies, and lice, with potential vectors including bed bugs and ticks.7–9Bartonella species prefer infecting mammalian erythrocytes and endothelial cells and have a broad host range, including various sylvatic and domestic animals.10,11Globally, Bartonella henselae is the most common species causing clinical manifestations in humans, dogs, and cats.12–14

The ability of Bartonella species to infect a wide variety of mammals, including several that serve as reservoirs for T. cruzi, raises the possibility of triatomines also being potential vectors of these bacteria, as observed in other research, given these close ecological relationships.5 Recently, in southern China, a study detected DNA from Bartonella species in 36.4 % (8/22) of Triatoma rubrofasciata analyzed.15 This species of triatomines has a cosmopolitan distribution, emerged outside Latin America and plays a global role in the transmission of Trypanosoma conorhini, a parasite with no reports of infection in humans. In the Americas, this insect is considered a secondary vector of T. cruzi.15,16 Previously, a study in French Guiana had reported a candidate species Bartonella rondonienses in 13/23 (56.5 %) triatomines of the species Eratyrus mucronatus.9 Although considered a species with wild habits, there is an adaptation of E. mucronatus to the destruction of its habitat, approaching areas inhabited by humans.17 This species has already been associated with occasional transmission of CD in Bolivia, and T. cruzi has already been detected in it in Brazil.18,19

A study conducted with 73 patients with chagasic cardiomyopathy detected Bartonella sp. DNA in 34 of them (46.6 %).20 Compared to the control group, these patients had 40 times more chances of presenting the infection. In the same study, Argentine patients seroreactive for CD without clinical disease (therefore with indeterminate CD) also showed a high prevalence of 11/32 (34.4 %) Bartonella sp. infection, a risk 2.5 times higher than patients with chagasic cardiomyopathy from the same country.

Triatoma sordida is the most collected triatomine species in Brazil in terms of absolute numbers, by entomological surveillance, being widely adapted to the peridomicile.21 Like Triatoma brasiliensis, this species is considered a secondary vector of T. cruzi, a significant epidemiological concern in Brazil.22 This species is naturally found under tree bark and also in bird nests.23 In the peridomicile, T. sordida is commonly found in chicken coops and under pieces of wood.24,25 And even though associated with birds, individuals infected with T. cruzi are found in these environments, posing a risk of CD transmission, especially for residents of rural areas.

Based on these findings, the present study was conducted with the purpose of investigating the co-detection of B. henselae DNA and its possible coinfection with T. cruzi in Brazilian triatomines collected in the peridomicile.

Materials and methods

In accordance with institutional guidelines and applicable animal ethics regulations, research involving insects and other invertebrates is exempt from animal ethics committee approval, as these organisms are not subject to oversight under current ethics review policies.

To analyze the occurrence of B. henselae and the potential co-detection with T. cruzi in triatomines collected in the field, the presence of DNA from these agents in bugs of the species T. sordida (Fig. 1) was analyzed.

Fig. 1.

Dorsal and ventral view of an adult female Triatoma sordida. Photos from the Image Bank of the Triatominae Collection ‒ Faculty of Pharmaceutical Sciences ‒ São Paulo State University, Araraquara campus.26

The triatomines analyzed in this study were obtained in March 2013 in peridomestic regions in the city of Seabra (latitude 12°25′3.03″S and longitude 41°46′9.21″W) in the state of Bahia, Brazil (Fig. 2). Insect collection was carried out manually, and subsequently, they were stored in 70 % alcohol.

Fig. 2.

In the image, a map of Brazil highlighting the state of Bahia. In closer view, the location of the city of Seabra in this state is observed.

Sample preparation

Surface decontamination of the triatomines was performed by two immersions, with agitation, in ethanol (70 %), each lasting 10 min. Subsequently, the insects were immersed in sterile PBS for 5 min and then dried in a laminar flow. Using a sterile scalpel, wings, legs, and antennae were removed, and the insects were cut sagittally. One-half was randomly selected for analysis, while the other part was stored. Each half designated for analysis was individually deposited into 1.5 mL microtubes and macerated with a sterile pestle using liquid nitrogen.

DNA extraction

DNA extraction was performed using the commercial QIAamp DNA Mini Kit (Qiagen®, Hilden, Germany) following the manufacturer's protocol.

Molecular analyses

In all samples, a PCR reaction was performed for a specific endogenous gene of the Triatominae subfamily targeting the Cytochrome Oxidase I (COI) fragment.27 This procedure aimed to evaluate both the quality of the extracted DNA and the absence of inhibitors in the reaction.

Subsequently, the samples were subjected to nested PCR analysis targeting the ftsZ gene specific to B. henselae and real-time PCR directed at the gltA gene, also specific to the same species of Bartonella.

Two types of controls were added to all reactions: one with only reagents of each reaction to ensure no contamination between the reagents and another with serial dilutions of B. henselae DNA to determine the sensitivity and limit of detection of each reaction. To prevent cross-contamination, the B. henselae DNA used as a control was synthetically prepared in such a way that its fragment was distinct from the expected fragment by the DNA band of wild B. henselae, thus easily identifiable and avoiding false positives resulting from contamination, as described.28

All samples were analyzed by conventional PCR for T. cruzi identification. The first PCR reaction was performed using the primers 121 (Forward) AAATAATGTACGGG (T/G) GAGATGCATGA and 122 (Reverse) GGTTCGATTGGGGTTGGTGAATATA, previously described by Sturm et al. and Wincker et al., which amplify fragments of the kinetoplast DNA (kDNA) of T. cruzi and Trypanosoma rangeli, a trypanosomatid also found in triatomines but not pathogenic to humans and other vertebrates.29,30 The PCR reaction and cycling conditions of this first reaction followed the steps of Valença-Barbosa et al. 31 The second reaction was performed with the primers TcH2AF and TcH2AR, isolating a fragment present in the non-coding 3′ region of the 1.2 kb histone H2A coding unit specifically from T. cruzi.32 The protocol used for this reaction was the same as that used by Lilioso M et al. 33

The PCR products were applied to a 2 % agarose gel and visualized with GelRed staining (Biotium Inc., Hayward, CA, USA). The absence of amplification products on the gel, specifically at 330 base pairs for the 121/122 primers and 234 base pairs for the TcH2AF/TcH2AR primers, was interpreted as indicative of no T. cruzi infection in the samples. All PCRs were performed with three positive controls for T. cruzi, including one DNA control extracted from a T. cruzi culture (TcI), and the other two from DNA extracted from the abdominal contents of Triatoma brasiliensis genotyped previously. Additionally, the negative controls used were NTC (non-template control) and a T. rangeli DNA.

Results

Eighty-one triatomines were analyzed. All samples showed amplification of the endogenous gene.

No sample showed DNA amplification for T. cruzi.

B. henselae DNA was detected in 23 out of 81 individuals (28.39 %) in at least one of the two species-specific reactions for B. henselae, with 13/23 in nested PCR (56.52 %) and 16/23 in real-time PCR (69.56 %). In six samples, both reactions (26.08 %) detected the bacterial DNA. The results can be better observed in the Venn diagram (Fig. 3).

Fig. 3.

Venn diagrams representing positive Bartonella sp. ‒ PCR results showing how many samples were amplified in each reaction and those detected in more than one PCR.

Of the 23 samples that resulted in DNA amplification, 9 (39.13 %) were subjected to sequencing, with seven amplicons obtained from nested PCR and four from real-time PCR. Two samples had their amplicons recovered from both reactions. All samples showed 100 % similarity with B. henselae.

Discussion

The study found a high prevalence of Bartonella sp. DNA detection in T. sordida collected in the peridomicile in an area with medium risk of vector-borne transmission of CD despite the low parasitic infection found in T. sordida from the same region (Fig. 4).34

Fig. 4.

Adapted map with the location of the city of Seabra within the distribution of cities with a medium degree of risk of Chagas disease transmission. Bahia, 2012.34

The detection of the bacterial DNA is not sufficient to confirm the vectorial capacity of triatomines to infect hosts through biting or feces.35 The genetic material could be into the blood freshly sucked from other animals, potential reservoirs of Bartonella spp.36 Previous studies evaluated the ability of Bartonella quintana to multiply in the intestine of bed bugs and demonstrated its viability in the feces of these insects.7 A similar study should be done with triatomine species.

The results of the study with patients with chagasic cardiomyopathy and indeterminate disease revealed a high prevalence of Bartonella sp. infection in these individuals.20 This observation suggests the possibility of the bacterial transmission by the same vector or by other hematophagous arthropods sharing the same environment.

Furthermore, if confirmed the intestinal multiplication of Bartonella sp. in triatomines, it will be necessary to evaluate whether the transmission of the bacterium occurs during the blood meal or, as with T. cruzi, from contact of the skin or mucous membranes with the feces of the arthropods. Transmission of Bartonella spp. through feces is the most likely, considering that in cats transmission between infected and uninfected animals does not occur without contact with feces from infected fleas.37,38 It is also important to observe if Bartonella spp. has the ability to multiply in the salivary glands of triatomines.

Given that B. henselae is the most frequent cause of disease in humans, species-specific reactions were used for this bacterium.39 Genus-specific PCRs should also be opportunistically performed in Triatoma sordida and other triatomine species, since Bartonella DNA has already been found in E. mucronatus and T. rubrofasciata.9,15

Based on the results of this study, further research is needed to confirm the vectorial competence of triatomines in acting as vectors of Bartonella spp., as the limitation of this study was finding DNA of these pathogens and not their viability. New research is also needed to investigate the diversity of Bartonella spp. present in these insects, as the analyses performed only targeted B. henselae. Likewise, it is necessary to verify the prevalence of these pathogens in other triatomine species. Since little is known about the ways that Bartonella spp. are maintained in natural environments, it is also crucial to verify if the cycle of these bacteria can be maintained through the entomophagy of hematophagous insects by potential vertebrate reservoirs.

Conclusion

The results of this study reveal high detection of B. henselae DNA in triatomines of the species T. sordida collected in peridomiciliary areas of the city of Seabra, Bahia. These findings have significant implications for the epidemiology of both diseases.

References
[1]
World Health Organization. Zoonotic disease: emerging public health threats in the Region. Available from: https://www.emro.who.int/about-who/rc61/zoonotic-diseases.html [Last Accessed; 10-August-2024].
[2]
F.R. Martins-Melo, A.N. Ramos Jr, C.H. Alencar, J Heukelbach.
Mortality from neglected tropical diseases in Brazil, 2000–2011.
Bull World Health Organ, 94 (2016), pp. 103-110
[3]
R. Zeledón, J.E. Rabinovich.
Chagas' disease: an ecological appraisal with special emphasis on its insect vectors.
Annu Rev Entomol, 26 (1981), pp. 101-133
[4]
A. Álvarez-Fernández, E.B. Breitschwerdt.
Solano-Gallego L. Bartonella infections in cats and dogs including zoonotic aspects.
Parasit Vectors, 11 (2018), pp. 624
[5]
C.B. Vieira, Y.R. Praça, K.L.D.S. Bentes, et al.
Triatomines: trypanosomatids, bacteria, and viruses potential vectors?.
Front Cell Infect Microbiol, 8 (2018), pp. 405
[6]
U. Okaro, A. Addisu, B. Casanas, B. Anderson.
Bartonella species, an emerging cause of blood-culture-negative endocarditis.
Clin Microbiol Rev, 30 (2017), pp. 709-746
[7]
H. Leulmi, I. Bitam, J.M. Berenger, et al.
Competence of cimex lectularius bed bugs for the transmission of bartonella quintana, the agent of trench fever.
PLoS Negl Trop Dis, 9 (2015),
[8]
W. Wechtaisong, S.I. Bonnet, Y.Y. Lien, S.T. Chuang, Y.L. Tsai.
Transmission of bartonella henselae within rhipicephalus sanguineus: data on the potential vector role of the tick.
PLoS Negl Trop Dis, 14 (2020),
[9]
M. Laroche, J.M. Berenger, O. Mediannikov, D. Raoult, P. Parola.
Detection of a potential new bartonella species "Candidatus Bartonella rondoniensis" in human biting kissing bugs (Reduviidae; Triatominae).
PLoS Negl Trop Dis., 11 (2017),
[10]
S. Zouari, F. Khrouf, Y. M'ghirbi, A Bouattour.
First molecular detection and characterization of zoonotic Bartonella species in fleas infesting domestic animals in Tunisia.
Parasit Vectors, 10 (2017), pp. 436
[11]
EB. Breitschwerdt.
Bartonellosis, One Health and all creatures great and small.
Vet Dermatol, 28 (2017), pp. 96
[12]
K.A. Lins, M.R. Drummond, P.E.N.F. Velho.
Cutaneous manifestations of bartonellosis.
An Bras Dermatol, 94 (2019), pp. 594-602
[13]
E.B. Breitschwerdt, R.G. Maggi, B.B. Chomel, M.R. Lappin.
Bartonellosis: an emerging infectious disease of zoonotic importance to animals and human beings.
J Vet Emerg Crit Care, 20 (2010), pp. 8-30
[14]
V.D. Miranda.
“Detection of DNA from Bartonella henselae in Dogs with Visceral Leishmaniasis” (Master's degree).
Universidade Estadual de Campinas (UNICAMP, (2024),
[15]
B. Zhang, R.A. Nurland, Y. Guan, et al.
Detection of Bartonella in kissing bugs Triatoma rubrofasciata collected from Huizhou City, South China.
New Microbes New Infect, 54 (2023),
[16]
J.P. Dujardin, T.X. Lam, P.T. Khoa, C.J. Schofield.
The rising importance of Triatoma rubrofasciata.
Mem Inst Oswaldo Cruz, 110 (2015), pp. 319-323
[17]
V.D.B Torres, R Cabrera.
Geographical distribution and intra-domiciliary capture of sylvatic triatomines in La Convención province, Cusco, Peru.
Rev Inst Med Trop Sao Paulo, 52 (2010), pp. 157-160
[18]
D.U. Meneguetti, O. Trevisan, R.M. Rosa, L.M. Camargo.
First report of Eratyrus mucronatus, Stal, 1859, (Hemiptera, Reduviidae, Triatominae), in the State of Rondônia, Brazil.
Rev Soc Bras Med Trop, 44 (2011), pp. 511-512
[19]
F.N.L. Barros, J.D.S.C. Vieira, F.D. Sampaio Júnior, et al.
Trypanosoma cruzi infection in triatomines (Hemiptera: reduviidae) from rural areas of the state of Pará, Brazil.
Zoonoses Public Health, 68 (2021), pp. 868-875
[20]
F.G. Corrêa, C.L. Pontes, R.M.M. Verzola, et al.
Association of Bartonella spp bacteremia with Chagas cardiomyopathy, endocarditis and arrhythmias in patients from South America.
Braz J Med Biol Res, 45 (2012), pp. 644-651
[21]
R. Gurgel-Gonçalves, C. Galvão, J. Costa, A.T Peterson.
Geographic distribution of chagas disease vectors in Brazil based on ecological niche modeling.
J Trop Med, 2012 (2012),
[22]
J. Costa, C.E. Almeida, E.M. Dotson, et al.
The epidemiologic importance of Triatoma brasiliensis as a chagas disease vector in Brazil: a revision of domiciliary captures during 1993-1999.
Mem Inst Oswaldo Cruz, 98 (2003), pp. 443-449
[23]
L. Diotaiuti, C.F. Loiola, P.L. Falcão, J.C. Dias.
The ecology of Triatoma sordida in natural environments in two different regions of the state of Minas Gerais, Brazil.
Rev Inst Med Trop Sao Paulo, 35 (1993), pp. 237-245
[24]
J.C. Rossi, E.C. Duarte, R. Gurgel-Gonçalves.
Factors associated with the occurrence of Triatoma sordida (Hemiptera: reduviidae) in rural localities of Central-West Brazil.
Mem Inst Oswaldo Cruz, 110 (2015), pp. 192-200
[25]
C.J. Belisário, G.C. Pessoa, P.F. dos Santos, L.S. Dias, A.C. Rosa, L. Diotaiuti.
Markers for the population genetics studies of Triatoma sordida (Hemiptera: reduviidae).
Parasit Vectors, 8 (2015), pp. 269
[26]
Paiva VFd, Ambrozini L.M., Pinotti H. Triatoma sordida Coleção de Triatominae - Unesp Araraquara. Available from: https://www2.fcfar.unesp.br/#!/triatominae/subfamilia-triatominae/triatoma/triatoma-sordida/. [Last Accessed; 10-August-2024].
[27]
E. Pfeiler, B.G. Bitler, J.M. Ramsey, C. Palacios-Cardiel, T.A. Markow.
Genetic variation, population structure, and phylogenetic relationships of Triatoma rubida and T. recurva (Hemiptera: reduviidae: triatominae) from the Sonoran Desert, insect vectors of the Chagas' disease parasite Trypanosoma cruzi.
Mol Phylogenet Evol, 41 (2006), pp. 209-221
[28]
A.S. Maekawa, L.S. Santos, P.E.N.F. Velho, M.R. Drummond.
Use of a synthetic oligonucleotide to detect false positives caused by cross-contamination in nested PCR Author links open overlay panel.
J Microbiol Methods, 226 (2024), pp. 107040
[29]
F. Guhl, G.A. Vallejo.
Trypanosoma (Herpetosoma) rangeli Tejera, 1920: an updated review.
Mem Inst Oswaldo Cruz, 98 (2003), pp. 435-442
[30]
P. Wincker, C. Britto, J.B. Pereira, M.A. Cardoso, W. Oelemann, C.M. Morel.
Use of a simplified polymerase chain reaction procedure to detect Trypanosoma cruzi in blood samples from chronic chagasic patients in a rural endemic area.
Am J Trop Med Hyg, 51 (1994), pp. 771-777
[31]
C. Valença-Barbosa, P. Finamore-Araujo, O.C. Moreira, et al.
Genotypic Trypanosoma cruzi distribution and parasite load differ ecotypically and according to parasite genotypes in Triatoma brasiliensis from endemic and outbreak areas in Northeastern Brazil.
Acta Trop, 222 (2021),
[32]
P.X. Pavia, G.A. Vallejo, M. Montilla, R.S. Nicholls, C.J. Puerta.
Detection of Trypanosoma cruzi and Trypanosoma rangeli infection in triatomine vectors by amplification of the histone H2A/SIRE and the sno-RNA-C11 genes.
Rev Inst Med Trop Sao Paulo, 49 (2007), pp. 23-30
[33]
M. Lilioso, C. Reigada, D. Pires-Silva, et al.
Dynamics of food sources, ecotypic distribution and Trypanosoma cruzi infection in Triatoma brasiliensis from the northeast of Brazil.
PLoS Negl Trop Dis, 14 (2020),
[34]
Bahia (Estado).
Secretaria da Saúde do Estado da Bahia (SESAB)/PCDCH SUVISA/DIVEP/CODTV.
[35]
A.E. Douglas.
Multiorganismal insects: diversity and function of resident microorganisms.
Annu Rev Entomol, 60 (2015), pp. 17-34
[36]
F. Noireau, P. Diosque, A.M. Jansen.
Trypanosoma cruzi: adaptation to its vectors and its hosts.
[37]
B.B. Chomel, H.-J. Boulouis, E.B. Breitschwerdt, et al.
Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors.
[38]
L. Foil, E. Andress, R.L. Freeland, et al.
Experimental infection of domestic cats with Bartonella henselae by inoculation of Ctenocephalides felis (Siphonaptera: pulicidae) feces.
J Med Entomol, 35 (1998), pp. 625-628
[39]
A. Harms, C. Dehio.
Intruders below the radar: molecular pathogenesis of Bartonella spp.
Clin Microbiol Rev, 25 (2012), pp. 42-78
Copyright © 2024. Sociedade Brasileira de Infectologia
Download PDF
The Brazilian Journal of Infectious Diseases
Article options
Tools