Original Article
Detection of Bartonella henselae DNA in Triatoma sordida collected in peridomiciliary environments
Luciene Silva dos Santosa, Alexandre Seiji Maekawab, Dayane Pires da Silvac, Carlos Eduardo Almeidad, Paulo Eduardo Neves Ferreira Velhoa,e,
, Marina Rovani Drummonda
Corresponding author
pvelho@unicamp.br
Corresponding author at: Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Rua Vital Brasil 50, Campinas, SP, Brazil.
Corresponding author at: Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Rua Vital Brasil 50, Campinas, SP, Brazil.
a Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Campinas, SP, Brazil
b Faculty of Medicine – Endocrinology, Memorial University of Newfoundland, St. John's, Newfoundland and Labrador, Canada
c Universidade de Campinas (UNICAMP), Instituto de Biologia, Programa de Pós-Graduação em Genética e Biologia Molecular, Campinas, SP, Brazil
d Universidade Federal do Rio de Janeiro (UFRJ), Instituto de Biologia, Laboratório de Entomologia, Rio de Janeiro, RJ, Brazil
e Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Departamento de Medicina, Divisão de Dermatologia, Campinas, SP, Brazil
Read
382
Timeswas read the article
79
Total PDF
303
Total HTML
Share statistics
array:22 [ "pii" => "S1413867024001582" "issn" => "14138670" "doi" => "10.1016/j.bjid.2024.103875" "estado" => "S250" "fechaPublicacion" => "2024-09-01" "aid" => "103875" "copyright" => "Sociedade Brasileira de Infectologia" "copyrightAnyo" => "2024" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:17 [ "pii" => "S1413867024001557" "issn" => "14138670" "doi" => "10.1016/j.bjid.2024.103872" "estado" => "S250" "fechaPublicacion" => "2024-09-01" "aid" => "103872" "copyright" => "Sociedade Brasileira de Infectologia" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Occurrence of sporotrichosis in Belém, Pará, Brazil: a metaphor for unsustainable socioeconomic development" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2522 "Ancho" => 3000 "Tamanyo" => 876650 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">Density of human cases of sporotrichosis and living conditions index (LCI), in the neighborhoods of Belém, Pará State, Brazil, from 2020 to 2022.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Nelson Veiga Gonçalves, Claudia do Socorro Carvalho Miranda, Bruna Costa de Souza, Matheus Pereira do Couto Rocha, Francisca Regina Oliveira Carneiro, Marcelino Antônio Costa Maués, Déborah Mara Costa de Oliveira, Maridelzira Betânia Moraes David, Mioni Thieli Figueiredo Magalhaes de Brito, Juarez Antonio Simões Quaresma" "autores" => array:10 [ 0 => array:2 [ "nombre" => "Nelson Veiga" "apellidos" => "Gonçalves" ] 1 => array:2 [ "nombre" => "Claudia do Socorro Carvalho" "apellidos" => "Miranda" ] 2 => array:2 [ "nombre" => "Bruna Costa de" "apellidos" => "Souza" ] 3 => array:2 [ "nombre" => "Matheus Pereira do Couto" "apellidos" => "Rocha" ] 4 => array:2 [ "nombre" => "Francisca Regina Oliveira" "apellidos" => "Carneiro" ] 5 => array:2 [ "nombre" => "Marcelino Antônio Costa" "apellidos" => "Maués" ] 6 => array:2 [ "nombre" => "Déborah Mara Costa de" "apellidos" => "Oliveira" ] 7 => array:2 [ "nombre" => "Maridelzira Betânia Moraes" "apellidos" => "David" ] 8 => array:2 [ "nombre" => "Mioni Thieli Figueiredo Magalhaes de" "apellidos" => "Brito" ] 9 => array:2 [ "nombre" => "Juarez Antonio Simões" "apellidos" => "Quaresma" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867024001557?idApp=UINPBA00003Y" "url" => "/14138670/0000002800000005/v8_202410110717/S1413867024001557/v8_202410110717/en/main.assets" ] "itemAnterior" => array:17 [ "pii" => "S1413867024001533" "issn" => "14138670" "doi" => "10.1016/j.bjid.2024.103870" "estado" => "S250" "fechaPublicacion" => "2024-09-01" "aid" => "103870" "copyright" => "Sociedade Brasileira de Infectologia" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Impact of multidisciplinary Endocarditis Team on management of infective endocarditis" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 828 "Ancho" => 3000 "Tamanyo" => 141992 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Fig. " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Flowchart of included patients. ET, Endocarditis-Team.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Nicolas Fourré, Virgile Zimmermann, Benoit Guery, Nicoleta Ianculescu, Piergiorgio Tozzi, Matthias Kirsch, Pierre Monney, Matthaios Papadimitriou-Olivgeris" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Nicolas" "apellidos" => "Fourré" ] 1 => array:2 [ "nombre" => "Virgile" "apellidos" => "Zimmermann" ] 2 => array:2 [ "nombre" => "Benoit" "apellidos" => "Guery" ] 3 => array:2 [ "nombre" => "Nicoleta" "apellidos" => "Ianculescu" ] 4 => array:2 [ "nombre" => "Piergiorgio" "apellidos" => "Tozzi" ] 5 => array:2 [ "nombre" => "Matthias" "apellidos" => "Kirsch" ] 6 => array:2 [ "nombre" => "Pierre" "apellidos" => "Monney" ] 7 => array:2 [ "nombre" => "Matthaios" "apellidos" => "Papadimitriou-Olivgeris" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867024001533?idApp=UINPBA00003Y" "url" => "/14138670/0000002800000005/v8_202410110717/S1413867024001533/v8_202410110717/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Detection of <span class="elsevierStyleItalic">Bartonella henselae</span> DNA in <span class="elsevierStyleItalic">Triatoma sordida</span> collected in peridomiciliary environments" "tieneTextoCompleto" => true "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Luciene Silva dos Santos, Alexandre Seiji Maekawa, Dayane Pires da Silva, Carlos Eduardo Almeida, Paulo Eduardo Neves Ferreira Velho, Marina Rovani Drummond" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Luciene Silva" "apellidos" => "dos Santos" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0001" ] ] ] 1 => array:3 [ "nombre" => "Alexandre Seiji" "apellidos" => "Maekawa" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0002" ] ] ] 2 => array:3 [ "nombre" => "Dayane Pires" "apellidos" => "da Silva" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0003" ] ] ] 3 => array:3 [ "nombre" => "Carlos Eduardo" "apellidos" => "Almeida" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0004" ] ] ] 4 => array:4 [ "nombre" => "Paulo Eduardo Neves Ferreira" "apellidos" => "Velho" "email" => array:1 [ 0 => "pvelho@unicamp.br" ] "referencia" => array:3 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0001" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0005" ] 2 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0001" ] ] ] 5 => array:3 [ "nombre" => "Marina Rovani" "apellidos" => "Drummond" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0001" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Campinas, SP, Brazil" "etiqueta" => "a" "identificador" => "aff0001" ] 1 => array:3 [ "entidad" => "Faculty of Medicine – Endocrinology, Memorial University of Newfoundland, St. John's, Newfoundland and Labrador, Canada" "etiqueta" => "b" "identificador" => "aff0002" ] 2 => array:3 [ "entidad" => "Universidade de Campinas (UNICAMP), Instituto de Biologia, Programa de Pós-Graduação em Genética e Biologia Molecular, Campinas, SP, Brazil" "etiqueta" => "c" "identificador" => "aff0003" ] 3 => array:3 [ "entidad" => "Universidade Federal do Rio de Janeiro (UFRJ), Instituto de Biologia, Laboratório de Entomologia, Rio de Janeiro, RJ, Brazil" "etiqueta" => "d" "identificador" => "aff0004" ] 4 => array:3 [ "entidad" => "Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Departamento de Medicina, Divisão de Dermatologia, Campinas, SP, Brazil" "etiqueta" => "e" "identificador" => "aff0005" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0001" "etiqueta" => "⁎" "correspondencia" => "Corresponding author at: Universidade de Campinas (UNICAMP), Faculdade de Ciências Médicas, Laboratório de Pesquisa Aplicada em Dermatologia e Infecção por Bartonella, Rua Vital Brasil 50, Campinas, SP, Brazil." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1930 "Ancho" => 3167 "Tamanyo" => 240046 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">In the image, a map of Brazil highlighting the state of Bahia. In closer view, the location of the city of Seabra in this state is observed.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0004">Introduction</span><p id="para0002" class="elsevierStylePara elsevierViewall">Among the zoonoses of interest in public health is Chagas Disease (CD), considered neglected by the World Health Organization (WHO). It is estimated that this disease affects around 6‒7 million people worldwide, and its underreporting emerges as a challenge since this disease has notable chances of cure when treated early.<a class="elsevierStyleCrossRef" href="#bib0001"><span class="elsevierStyleSup">1</span></a> A study evaluating mortality caused by neglected diseases in Brazil between 2000‒2011 showed that CD was responsible for 76.7 % of all deaths.<a class="elsevierStyleCrossRef" href="#bib0002"><span class="elsevierStyleSup">2</span></a></p><p id="para0003" class="elsevierStylePara elsevierViewall">The agent of CD, <span class="elsevierStyleItalic">Trypanosoma cruzi</span>, is known to have several triatomines species associated with its transmission, in addition to demonstrating a wide variety of mammalian hosts. Among these hosts, many are carriers of other pathogens that also employ hematophagous arthropods as vectors.<a class="elsevierStyleCrossRefs" href="#bib0003"><span class="elsevierStyleSup">3–5</span></a></p><p id="para0004" class="elsevierStylePara elsevierViewall">One such group of pathogens includes the genus <span class="elsevierStyleItalic">Bartonella</span>, comprising over 40 species of gram-negative bacteria.<a class="elsevierStyleCrossRef" href="#bib0006"><span class="elsevierStyleSup">6</span></a> These bacteria are primarily transmitted by vectors like fleas, sandflies, and lice, with potential vectors including bed bugs and ticks.<a class="elsevierStyleCrossRefs" href="#bib0007"><span class="elsevierStyleSup">7–9</span></a><span class="elsevierStyleItalic">Bartonella</span> species prefer infecting mammalian erythrocytes and endothelial cells and have a broad host range, including various sylvatic and domestic animals.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">10</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0011"><span class="elsevierStyleSup">11</span></a>Globally, <span class="elsevierStyleItalic">Bartonella henselae</span> is the most common species causing clinical manifestations in humans, dogs, and cats.<a class="elsevierStyleCrossRefs" href="#bib0012"><span class="elsevierStyleSup">12–14</span></a></p><p id="para0005" class="elsevierStylePara elsevierViewall">The ability of <span class="elsevierStyleItalic">Bartonella</span> species to infect a wide variety of mammals, including several that serve as reservoirs for <span class="elsevierStyleItalic">T. cruzi</span>, raises the possibility of triatomines also being potential vectors of these bacteria, as observed in other research, given these close ecological relationships.<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">5</span></a> Recently, in southern China, a study detected DNA from <span class="elsevierStyleItalic">Bartonella</span> species in 36.4 % (8/22) of <span class="elsevierStyleItalic">Triatoma rubrofasciata</span> analyzed.<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">15</span></a> This species of triatomines has a cosmopolitan distribution, emerged outside Latin America and plays a global role in the transmission of <span class="elsevierStyleItalic">Trypanosoma conorhini</span>, a parasite with no reports of infection in humans. In the Americas, this insect is considered a secondary vector of <span class="elsevierStyleItalic">T. cruzi</span>.<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">15</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0016"><span class="elsevierStyleSup">16</span></a> Previously, a study in French Guiana had reported a candidate species <span class="elsevierStyleItalic">Bartonella rondonienses</span> in 13/23 (56.5 %) triatomines of the species <span class="elsevierStyleItalic">Eratyrus mucronatu</span>s.<a class="elsevierStyleCrossRef" href="#bib0009"><span class="elsevierStyleSup">9</span></a> Although considered a species with wild habits, there is an adaptation of <span class="elsevierStyleItalic">E. mucronatus</span> to the destruction of its habitat, approaching areas inhabited by humans.<a class="elsevierStyleCrossRef" href="#bib0017"><span class="elsevierStyleSup">17</span></a> This species has already been associated with occasional transmission of CD in Bolivia, and <span class="elsevierStyleItalic">T. cruzi</span> has already been detected in it in Brazil.<a class="elsevierStyleCrossRef" href="#bib0018"><span class="elsevierStyleSup">18</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0019"><span class="elsevierStyleSup">19</span></a></p><p id="para0006" class="elsevierStylePara elsevierViewall">A study conducted with 73 patients with chagasic cardiomyopathy detected <span class="elsevierStyleItalic">Bartonella</span> sp. DNA in 34 of them (46.6 %).<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">20</span></a> Compared to the control group, these patients had 40 times more chances of presenting the infection. In the same study, Argentine patients seroreactive for CD without clinical disease (therefore with indeterminate CD) also showed a high prevalence of 11/32 (34.4 %) <span class="elsevierStyleItalic">Bartonella</span> sp. infection, a risk 2.5 times higher than patients with chagasic cardiomyopathy from the same country.</p><p id="para0007" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Triatoma sordida</span> is the most collected triatomine species in Brazil in terms of absolute numbers, by entomological surveillance, being widely adapted to the peridomicile.<a class="elsevierStyleCrossRef" href="#bib0021"><span class="elsevierStyleSup">21</span></a> Like <span class="elsevierStyleItalic">Triatoma brasiliensis</span>, this species is considered a secondary vector of <span class="elsevierStyleItalic">T. cruzi</span>, a significant epidemiological concern in Brazil.<a class="elsevierStyleCrossRef" href="#bib0022"><span class="elsevierStyleSup">22</span></a> This species is naturally found under tree bark and also in bird nests.<a class="elsevierStyleCrossRef" href="#bib0023"><span class="elsevierStyleSup">23</span></a> In the peridomicile, <span class="elsevierStyleItalic">T. sordida</span> is commonly found in chicken coops and under pieces of wood.<a class="elsevierStyleCrossRef" href="#bib0024"><span class="elsevierStyleSup">24</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">25</span></a> And even though associated with birds, individuals infected with <span class="elsevierStyleItalic">T. cruzi</span> are found in these environments, posing a risk of CD transmission, especially for residents of rural areas.</p><p id="para0008" class="elsevierStylePara elsevierViewall">Based on these findings, the present study was conducted with the purpose of investigating the co-detection of <span class="elsevierStyleItalic">B. henselae</span> DNA and its possible coinfection with <span class="elsevierStyleItalic">T. cruzi</span> in Brazilian triatomines collected in the peridomicile.</p></span><span id="sec0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0005">Materials and methods</span><p id="para0009" class="elsevierStylePara elsevierViewall">In accordance with institutional guidelines and applicable animal ethics regulations, research involving insects and other invertebrates is exempt from animal ethics committee approval, as these organisms are not subject to oversight under current ethics review policies.</p><p id="para0010" class="elsevierStylePara elsevierViewall">To analyze the occurrence of <span class="elsevierStyleItalic">B. henselae</span> and the potential co-detection with <span class="elsevierStyleItalic">T. cruzi</span> in triatomines collected in the field, the presence of DNA from these agents in bugs of the species <span class="elsevierStyleItalic">T. sordida</span> (<a class="elsevierStyleCrossRef" href="#fig0001">Fig. 1</a>) was analyzed.</p><elsevierMultimedia ident="fig0001"></elsevierMultimedia><p id="para0011" class="elsevierStylePara elsevierViewall">The triatomines analyzed in this study were obtained in March 2013 in peridomestic regions in the city of Seabra (latitude 12°25′3.03″S and longitude 41°46′9.21″W) in the state of Bahia, Brazil (<a class="elsevierStyleCrossRef" href="#fig0002">Fig. 2</a>). Insect collection was carried out manually, and subsequently, they were stored in 70 % alcohol.</p><elsevierMultimedia ident="fig0002"></elsevierMultimedia><span id="sec0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0006">Sample preparation</span><p id="para0012" class="elsevierStylePara elsevierViewall">Surface decontamination of the triatomines was performed by two immersions, with agitation, in ethanol (70 %), each lasting 10 min. Subsequently, the insects were immersed in sterile PBS for 5 min and then dried in a laminar flow. Using a sterile scalpel, wings, legs, and antennae were removed, and the insects were cut sagittally. One-half was randomly selected for analysis, while the other part was stored. Each half designated for analysis was individually deposited into 1.5 mL microtubes and macerated with a sterile pestle using liquid nitrogen.</p></span><span id="sec0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0007">DNA extraction</span><p id="para0013" class="elsevierStylePara elsevierViewall">DNA extraction was performed using the commercial <span class="elsevierStyleItalic">QIAamp</span> DNA <span class="elsevierStyleItalic">Mini Kit</span> (Qiagen®, Hilden, Germany) following the manufacturer's protocol.</p></span><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0008">Molecular analyses</span><p id="para0014" class="elsevierStylePara elsevierViewall">In all samples, a PCR reaction was performed for a specific endogenous gene of the Triatominae subfamily targeting the Cytochrome Oxidase I (COI) fragment.<a class="elsevierStyleCrossRef" href="#bib0027"><span class="elsevierStyleSup">27</span></a> This procedure aimed to evaluate both the quality of the extracted DNA and the absence of inhibitors in the reaction.</p><p id="para0015" class="elsevierStylePara elsevierViewall">Subsequently, the samples were subjected to nested PCR analysis targeting the <span class="elsevierStyleItalic">ftsZ</span> gene specific to <span class="elsevierStyleItalic">B. henselae</span> and real-time PCR directed at the <span class="elsevierStyleItalic">gltA</span> gene, also specific to the same species of <span class="elsevierStyleItalic">Bartonella</span>.</p><p id="para0016" class="elsevierStylePara elsevierViewall">Two types of controls were added to all reactions: one with only reagents of each reaction to ensure no contamination between the reagents and another with serial dilutions of <span class="elsevierStyleItalic">B. henselae</span> DNA to determine the sensitivity and limit of detection of each reaction. To prevent cross-contamination, the <span class="elsevierStyleItalic">B. henselae</span> DNA used as a control was synthetically prepared in such a way that its fragment was distinct from the expected fragment by the DNA band of wild <span class="elsevierStyleItalic">B. henselae</span>, thus easily identifiable and avoiding false positives resulting from contamination, as described.<a class="elsevierStyleCrossRef" href="#bib0028"><span class="elsevierStyleSup">28</span></a></p><p id="para0017" class="elsevierStylePara elsevierViewall">All samples were analyzed by conventional PCR for <span class="elsevierStyleItalic">T. cruzi</span> identification. The first PCR reaction was performed using the primers 121 (Forward) AAATAATGTACGGG (T/G) GAGATGCATGA and 122 (Reverse) GGTTCGATTGGGGTTGGTGAATATA, previously described by Sturm et al. and Wincker et al., which amplify fragments of the kinetoplast DNA (kDNA) of <span class="elsevierStyleItalic">T. cruzi</span> and <span class="elsevierStyleItalic">Trypanosoma rangeli</span>, a trypanosomatid also found in triatomines but not pathogenic to humans and other vertebrates.<a class="elsevierStyleCrossRef" href="#bib0029"><span class="elsevierStyleSup">29</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">30</span></a> The PCR reaction and cycling conditions of this first reaction followed the steps of Valença-Barbosa et al. <a class="elsevierStyleCrossRef" href="#bib0031"><span class="elsevierStyleSup">31</span></a> The second reaction was performed with the primers TcH2AF and TcH2AR, isolating a fragment present in the non-coding 3′ region of the 1.2 kb histone H2A coding unit specifically from <span class="elsevierStyleItalic">T. cruzi</span>.<a class="elsevierStyleCrossRef" href="#bib0032"><span class="elsevierStyleSup">32</span></a> The protocol used for this reaction was the same as that used by Lilioso M et al. <a class="elsevierStyleCrossRef" href="#bib0033"><span class="elsevierStyleSup">33</span></a></p><p id="para0018" class="elsevierStylePara elsevierViewall">The PCR products were applied to a 2 % agarose gel and visualized with GelRed staining (Biotium Inc., Hayward, CA, USA). The absence of amplification products on the gel, specifically at 330 base pairs for the 121/122 primers and 234 base pairs for the TcH2AF/TcH2AR primers, was interpreted as indicative of no <span class="elsevierStyleItalic">T. cruzi</span> infection in the samples. All PCRs were performed with three positive controls for <span class="elsevierStyleItalic">T. cruzi</span>, including one DNA control extracted from a <span class="elsevierStyleItalic">T. cruzi</span> culture (TcI), and the other two from DNA extracted from the abdominal contents of <span class="elsevierStyleItalic">Triatoma brasiliensis</span> genotyped previously. Additionally, the negative controls used were NTC (non-template control) and a <span class="elsevierStyleItalic">T. rangeli</span> DNA.</p></span></span><span id="sec0006" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0009">Results</span><p id="para0019" class="elsevierStylePara elsevierViewall">Eighty-one triatomines were analyzed. All samples showed amplification of the endogenous gene.</p><p id="para0020" class="elsevierStylePara elsevierViewall">No sample showed DNA amplification for <span class="elsevierStyleItalic">T. cruzi</span>.</p><p id="para0021" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">B. henselae</span> DNA was detected in 23 out of 81 individuals (28.39 %) in at least one of the two species-specific reactions for <span class="elsevierStyleItalic">B. henselae</span>, with 13/23 in nested PCR (56.52 %) and 16/23 in real-time PCR (69.56 %). In six samples, both reactions (26.08 %) detected the bacterial DNA. The results can be better observed in the Venn diagram (<a class="elsevierStyleCrossRef" href="#fig0003">Fig. 3</a>).</p><elsevierMultimedia ident="fig0003"></elsevierMultimedia><p id="para0022" class="elsevierStylePara elsevierViewall">Of the 23 samples that resulted in DNA amplification, 9 (39.13 %) were subjected to sequencing, with seven amplicons obtained from nested PCR and four from real-time PCR. Two samples had their amplicons recovered from both reactions. All samples showed 100 % similarity with <span class="elsevierStyleItalic">B. henselae</span>.</p></span><span id="sec0007" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0010">Discussion</span><p id="para0023" class="elsevierStylePara elsevierViewall">The study found a high prevalence of <span class="elsevierStyleItalic">Bartonell</span>a sp. DNA detection in <span class="elsevierStyleItalic">T. sordida</span> collected in the peridomicile in an area with medium risk of vector-borne transmission of CD despite the low parasitic infection found in <span class="elsevierStyleItalic">T. sordida</span> from the same region (<a class="elsevierStyleCrossRef" href="#fig0004">Fig. 4</a>).<a class="elsevierStyleCrossRef" href="#bib0034"><span class="elsevierStyleSup">34</span></a></p><elsevierMultimedia ident="fig0004"></elsevierMultimedia><p id="para0024" class="elsevierStylePara elsevierViewall">The detection of the bacterial DNA is not sufficient to confirm the vectorial capacity of triatomines to infect hosts through biting or feces.<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">35</span></a> The genetic material could be into the blood freshly sucked from other animals, potential reservoirs of <span class="elsevierStyleItalic">Bartonella</span> spp.<a class="elsevierStyleCrossRef" href="#bib0036"><span class="elsevierStyleSup">36</span></a> Previous studies evaluated the ability of <span class="elsevierStyleItalic">Bartonella quintana</span> to multiply in the intestine of bed bugs and demonstrated its viability in the feces of these insects.<a class="elsevierStyleCrossRef" href="#bib0007"><span class="elsevierStyleSup">7</span></a> A similar study should be done with triatomine species.</p><p id="para0025" class="elsevierStylePara elsevierViewall">The results of the study with patients with chagasic cardiomyopathy and indeterminate disease revealed a high prevalence of <span class="elsevierStyleItalic">Bartonella</span> sp. infection in these individuals.<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">20</span></a> This observation suggests the possibility of the bacterial transmission by the same vector or by other hematophagous arthropods sharing the same environment.</p><p id="para0026" class="elsevierStylePara elsevierViewall">Furthermore, if confirmed the intestinal multiplication of <span class="elsevierStyleItalic">Bartonella</span> sp. in triatomines, it will be necessary to evaluate whether the transmission of the bacterium occurs during the blood meal or, as with <span class="elsevierStyleItalic">T. cruzi</span>, from contact of the skin or mucous membranes with the feces of the arthropods. Transmission of <span class="elsevierStyleItalic">Bartonella</span> spp. through feces is the most likely, considering that in cats transmission between infected and uninfected animals does not occur without contact with feces from infected fleas.<a class="elsevierStyleCrossRef" href="#bib0037"><span class="elsevierStyleSup">37</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0038"><span class="elsevierStyleSup">38</span></a> It is also important to observe if <span class="elsevierStyleItalic">Bartonella</span> spp. has the ability to multiply in the salivary glands of triatomines.</p><p id="para0027" class="elsevierStylePara elsevierViewall">Given that <span class="elsevierStyleItalic">B. henselae</span> is the most frequent cause of disease in humans, species-specific reactions were used for this bacterium.<a class="elsevierStyleCrossRef" href="#bib0039"><span class="elsevierStyleSup">39</span></a> Genus-specific PCRs should also be opportunistically performed in <span class="elsevierStyleItalic">Triatoma sordida</span> and other triatomine species, since <span class="elsevierStyleItalic">Bartonella</span> DNA has already been found in <span class="elsevierStyleItalic">E. mucronatus</span> and <span class="elsevierStyleItalic">T. rubrofasciata</span>.<a class="elsevierStyleCrossRef" href="#bib0009"><span class="elsevierStyleSup">9</span></a><span class="elsevierStyleSup">,</span><a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">15</span></a></p><p id="para0028" class="elsevierStylePara elsevierViewall">Based on the results of this study, further research is needed to confirm the vectorial competence of triatomines in acting as vectors of <span class="elsevierStyleItalic">Bartonella</span> spp., as the limitation of this study was finding DNA of these pathogens and not their viability. New research is also needed to investigate the diversity of <span class="elsevierStyleItalic">Bartonella</span> spp. present in these insects, as the analyses performed only targeted <span class="elsevierStyleItalic">B. henselae</span>. Likewise, it is necessary to verify the prevalence of these pathogens in other triatomine species. Since little is known about the ways that <span class="elsevierStyleItalic">Bartonella</span> spp. are maintained in natural environments, it is also crucial to verify if the cycle of these bacteria can be maintained through the entomophagy of hematophagous insects by potential vertebrate reservoirs.</p></span><span id="sec0008" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0011">Conclusion</span><p id="para0029" class="elsevierStylePara elsevierViewall">The results of this study reveal high detection of <span class="elsevierStyleItalic">B. henselae</span> DNA in triatomines of the species <span class="elsevierStyleItalic">T. sordida</span> collected in peridomiciliary areas of the city of Seabra, Bahia. These findings have significant implications for the epidemiology of both diseases.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:8 [ 0 => array:3 [ "identificador" => "xres2270184" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abss0001" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1892702" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "sec0001" "titulo" => "Introduction" ] 3 => array:3 [ "identificador" => "sec0002" "titulo" => "Materials and methods" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0003" "titulo" => "Sample preparation" ] 1 => array:2 [ "identificador" => "sec0004" "titulo" => "DNA extraction" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Molecular analyses" ] ] ] 4 => array:2 [ "identificador" => "sec0006" "titulo" => "Results" ] 5 => array:2 [ "identificador" => "sec0007" "titulo" => "Discussion" ] 6 => array:2 [ "identificador" => "sec0008" "titulo" => "Conclusion" ] 7 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2024-03-14" "fechaAceptado" => "2024-09-17" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1892702" "palabras" => array:4 [ 0 => "<span class="elsevierStyleItalic">Bartonella henselae</span>" 1 => "Chagas disease" 2 => "Endocarditis" 3 => "<span class="elsevierStyleItalic">Trypanosoma cruzi</span>" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><p id="spara005" class="elsevierStyleSimplePara elsevierViewall">Bartonelloses represent a group of potentially fatal diseases associated with various clinical manifestations including endocarditis. Caused by bacteria belonging to the genus <span class="elsevierStyleItalic">Bartonella</span>, these microorganisms have a remarkable ability to infect mammals, and their transmission is commonly associated with hematophagous vectors such as fleas, lice, mosquitoes, and ticks. The aim of this study was to evaluate the occurrence of <span class="elsevierStyleItalic">Bartonella</span> sp. DNA in 81 triatomines of the species <span class="elsevierStyleItalic">Triatoma sordida</span> collected in the field in peri‑domiciliary areas of the Brazilian city of Seabra, located in the state of Bahia. Nested PCR was conducted targeting the <span class="elsevierStyleItalic">ftsZ</span> gene and real-time PCR targeting the <span class="elsevierStyleItalic">gltA</span> gene, both representing specific reactions for <span class="elsevierStyleItalic">Bartonella henselae</span>. Additionally, conventional PCR targeting kDNA was employed to evaluate the presence of <span class="elsevierStyleItalic">Trypanosoma cruzi.</span> Of the samples tested, 23/81 (28.39 %) bugs showed positive PCR for <span class="elsevierStyleItalic">B. henselae</span>. No sample showed positive PCR for <span class="elsevierStyleItalic">T. cruzi</span>. The high prevalence of triatomines with a positive PCR for <span class="elsevierStyleItalic">B. henselae</span> emphasizes the close relationship between these insects and the bacteria, indicating the need for further studies to investigate the vectorial potential of these kissing bugs.</p></span>" ] ] "multimedia" => array:4 [ 0 => array:8 [ "identificador" => "fig0001" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1096 "Ancho" => 1500 "Tamanyo" => 109100 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0001" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Dorsal and ventral view of an adult female <span class="elsevierStyleItalic">Triatoma sordida</span>. Photos from the Image Bank of the Triatominae Collection ‒ Faculty of Pharmaceutical Sciences ‒ São Paulo State University, Araraquara campus.<a class="elsevierStyleCrossRef" href="#bib0026"><span class="elsevierStyleSup">26</span></a></p>" ] ] 1 => array:8 [ "identificador" => "fig0002" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1930 "Ancho" => 3167 "Tamanyo" => 240046 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0002" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">In the image, a map of Brazil highlighting the state of Bahia. In closer view, the location of the city of Seabra in this state is observed.</p>" ] ] 2 => array:8 [ "identificador" => "fig0003" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1095 "Ancho" => 1500 "Tamanyo" => 70628 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0003" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Venn diagrams representing positive <span class="elsevierStyleItalic">Bartonella</span> sp. ‒ PCR results showing how many samples were amplified in each reaction and those detected in more than one PCR.</p>" ] ] 3 => array:8 [ "identificador" => "fig0004" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1679 "Ancho" => 1500 "Tamanyo" => 287857 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "alt0004" "detalle" => "Fig " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "<p id="spara004" class="elsevierStyleSimplePara elsevierViewall">Adapted map with the location of the city of Seabra within the distribution of cities with a medium degree of risk of Chagas disease transmission. Bahia, 2012.<a class="elsevierStyleCrossRef" href="#bib0034"><span class="elsevierStyleSup">34</span></a></p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "cebibsec1" "bibliografiaReferencia" => array:39 [ 0 => array:3 [ "identificador" => "bib0001" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "World Health Organization. Zoonotic disease: emerging public health threats in the Region. Available from: <a target="_blank" href="https://www.emro.who.int/about-who/rc61/zoonotic-diseases.html">https://www.emro.who.int/about-who/rc61/zoonotic-diseases.html</a> [Last Accessed; 10-August-2024]." ] ] ] 1 => array:3 [ "identificador" => "bib0002" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mortality from neglected tropical diseases in Brazil, 2000–2011" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "F.R. Martins-Melo" 1 => "A.N. Ramos Jr" 2 => "C.H. Alencar" 3 => "J Heukelbach" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2471/BLT.15.152363" "Revista" => array:6 [ "tituloSerie" => "Bull World Health Organ" "fecha" => "2016" "volumen" => "94" "paginaInicial" => "103" "paginaFinal" => "110" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26908960" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0003" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chagas' disease: an ecological appraisal with special emphasis on its insect vectors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R. Zeledón" 1 => "J.E. Rabinovich" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Annu Rev Entomol" "fecha" => "1981" "volumen" => "26" "paginaInicial" => "101" "paginaFinal" => "133" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0004" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Solano-Gallego L. Bartonella infections in cats and dogs including zoonotic aspects" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A. Álvarez-Fernández" 1 => "E.B. Breitschwerdt" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s13071-018-3152-6" "Revista" => array:5 [ "tituloSerie" => "Parasit Vectors" "fecha" => "2018" "volumen" => "11" "paginaInicial" => "624" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30514361" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0005" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Triatomines: trypanosomatids, bacteria, and viruses potential vectors?" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "C.B. Vieira" 1 => "Y.R. Praça" 2 => "K.L.D.S. Bentes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fcimb.2018.00405" "Revista" => array:5 [ "tituloSerie" => "Front Cell Infect Microbiol" "fecha" => "2018" "volumen" => "8" "paginaInicial" => "405" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30505806" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0006" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bartonella species, an emerging cause of blood-culture-negative endocarditis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "U. Okaro" 1 => "A. Addisu" 2 => "B. Casanas" 3 => "B. Anderson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2017" "volumen" => "30" "paginaInicial" => "709" "paginaFinal" => "746" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0007" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Competence of cimex lectularius bed bugs for the transmission of bartonella quintana, the agent of trench fever" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "H. Leulmi" 1 => "I. Bitam" 2 => "J.M. Berenger" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "PLoS Negl Trop Dis" "fecha" => "2015" "volumen" => "9" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0008" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Transmission of bartonella henselae within rhipicephalus sanguineus: data on the potential vector role of the tick" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "W. Wechtaisong" 1 => "S.I. Bonnet" 2 => "Y.Y. Lien" 3 => "S.T. Chuang" 4 => "Y.L. Tsai" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "PLoS Negl Trop Dis" "fecha" => "2020" "volumen" => "14" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0009" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of a potential new bartonella species "Candidatus Bartonella rondoniensis" in human biting kissing bugs (Reduviidae; Triatominae)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Laroche" 1 => "J.M. Berenger" 2 => "O. Mediannikov" 3 => "D. Raoult" 4 => "P. Parola" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "PLoS Negl Trop Dis." "fecha" => "2017" "volumen" => "11" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0010" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "First molecular detection and characterization of zoonotic Bartonella species in fleas infesting domestic animals in Tunisia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S. Zouari" 1 => "F. Khrouf" 2 => "Y. M'ghirbi" 3 => "A Bouattour" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Parasit Vectors" "fecha" => "2017" "volumen" => "10" "paginaInicial" => "436" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0011" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bartonellosis, One Health and all creatures great and small" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "EB. Breitschwerdt" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Vet Dermatol" "fecha" => "2017" "volumen" => "28" "paginaInicial" => "96" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0012" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cutaneous manifestations of bartonellosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "K.A. Lins" 1 => "M.R. Drummond" 2 => "P.E.N.F. Velho" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "An Bras Dermatol" "fecha" => "2019" "volumen" => "94" "paginaInicial" => "594" "paginaFinal" => "602" "itemHostRev" => array:3 [ "pii" => "S016503272032766X" "estado" => "S300" "issn" => "01650327" ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0013" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bartonellosis: an emerging infectious disease of zoonotic importance to animals and human beings" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "E.B. Breitschwerdt" 1 => "R.G. Maggi" 2 => "B.B. Chomel" 3 => "M.R. Lappin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Vet Emerg Crit Care" "fecha" => "2010" "volumen" => "20" "paginaInicial" => "8" "paginaFinal" => "30" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0014" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "“Detection of DNA from Bartonella henselae in Dogs with Visceral Leishmaniasis” (Master's degree)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "V.D. Miranda" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:2 [ "fecha" => "2024" "editorial" => "Universidade Estadual de Campinas (UNICAMP" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0015" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of Bartonella in kissing bugs Triatoma rubrofasciata collected from Huizhou City, South China" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "B. Zhang" 1 => "R.A. Nurland" 2 => "Y. Guan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "New Microbes New Infect" "fecha" => "2023" "volumen" => "54" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0016" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The rising importance of Triatoma rubrofasciata" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.P. Dujardin" 1 => "T.X. Lam" 2 => "P.T. Khoa" 3 => "C.J. Schofield" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1590/0074-02760140446" "Revista" => array:7 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2015" "volumen" => "110" "paginaInicial" => "319" "paginaFinal" => "323" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25807471" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0165032720327798" "estado" => "S300" "issn" => "01650327" ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0017" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Geographical distribution and intra-domiciliary capture of sylvatic triatomines in La Convención province, Cusco, Peru" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "V.D.B Torres" 1 => "R Cabrera" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "2010" "volumen" => "52" "paginaInicial" => "157" "paginaFinal" => "160" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0018" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "First report of Eratyrus mucronatus, Stal, 1859, (Hemiptera, Reduviidae, Triatominae), in the State of Rondônia, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "D.U. Meneguetti" 1 => "O. Trevisan" 2 => "R.M. Rosa" 3 => "L.M. Camargo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Soc Bras Med Trop" "fecha" => "2011" "volumen" => "44" "paginaInicial" => "511" "paginaFinal" => "512" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0019" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Trypanosoma cruzi infection in triatomines (Hemiptera: reduviidae) from rural areas of the state of Pará, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "F.N.L. Barros" 1 => "J.D.S.C. Vieira" 2 => "F.D. Sampaio Júnior" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Zoonoses Public Health" "fecha" => "2021" "volumen" => "68" "paginaInicial" => "868" "paginaFinal" => "875" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0020" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of Bartonella spp bacteremia with Chagas cardiomyopathy, endocarditis and arrhythmias in patients from South America" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "F.G. Corrêa" 1 => "C.L. Pontes" 2 => "R.M.M. Verzola" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Braz J Med Biol Res" "fecha" => "2012" "volumen" => "45" "paginaInicial" => "644" "paginaFinal" => "651" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0021" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Geographic distribution of chagas disease vectors in Brazil based on ecological niche modeling" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "R. Gurgel-Gonçalves" 1 => "C. Galvão" 2 => "J. Costa" 3 => "A.T Peterson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "J Trop Med" "fecha" => "2012" "volumen" => "2012" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0022" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The epidemiologic importance of Triatoma brasiliensis as a chagas disease vector in Brazil: a revision of domiciliary captures during 1993-1999" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "J. Costa" 1 => "C.E. Almeida" 2 => "E.M. Dotson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2003" "volumen" => "98" "numero" => "4" "paginaInicial" => "443" "paginaFinal" => "449" "itemHostRev" => array:3 [ "pii" => "S0165032718312205" "estado" => "S300" "issn" => "01650327" ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0023" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The ecology of Triatoma sordida in natural environments in two different regions of the state of Minas Gerais, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L. Diotaiuti" 1 => "C.F. Loiola" 2 => "P.L. Falcão" 3 => "J.C. Dias" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "1993" "volumen" => "35" "paginaInicial" => "237" "paginaFinal" => "245" ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0024" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Factors associated with the occurrence of Triatoma sordida (Hemiptera: reduviidae) in rural localities of Central-West Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.C. Rossi" 1 => "E.C. Duarte" 2 => "R. Gurgel-Gonçalves" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1590/0074-02760140395" "Revista" => array:6 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2015" "volumen" => "110" "paginaInicial" => "192" "paginaFinal" => "200" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25946242" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0025" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Markers for the population genetics studies of Triatoma sordida (Hemiptera: reduviidae)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C.J. Belisário" 1 => "G.C. Pessoa" 2 => "P.F. dos Santos" 3 => "L.S. Dias" 4 => "A.C. Rosa" 5 => "L. Diotaiuti" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s13071-015-0879-1" "Revista" => array:5 [ "tituloSerie" => "Parasit Vectors" "fecha" => "2015" "volumen" => "8" "paginaInicial" => "269" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25963633" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0026" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Paiva VFd, Ambrozini L.M., Pinotti H. Triatoma sordida Coleção de Triatominae - Unesp Araraquara. Available from: <a target="_blank" href="https://www2.fcfar.unesp.br/#!/triatominae/subfamilia-triatominae/triatoma/triatoma-sordida/">https://www2.fcfar.unesp.br/#!/triatominae/subfamilia-triatominae/triatoma/triatoma-sordida/</a>. [Last Accessed; 10-August-2024]." ] ] ] 26 => array:3 [ "identificador" => "bib0027" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic variation, population structure, and phylogenetic relationships of Triatoma rubida and T. recurva (Hemiptera: reduviidae: triatominae) from the Sonoran Desert, insect vectors of the Chagas' disease parasite Trypanosoma cruzi" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "E. Pfeiler" 1 => "B.G. Bitler" 2 => "J.M. Ramsey" 3 => "C. Palacios-Cardiel" 4 => "T.A. Markow" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ympev.2006.07.001" "Revista" => array:6 [ "tituloSerie" => "Mol Phylogenet Evol" "fecha" => "2006" "volumen" => "41" "paginaInicial" => "209" "paginaFinal" => "221" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16934496" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0028" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Use of a synthetic oligonucleotide to detect false positives caused by cross-contamination in nested PCR Author links open overlay panel" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A.S. Maekawa" 1 => "L.S. Santos" 2 => "P.E.N.F. Velho" 3 => "M.R. Drummond" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Microbiol Methods" "fecha" => "2024" "volumen" => "226" "paginaInicial" => "107040" ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0029" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Trypanosoma (Herpetosoma) rangeli Tejera, 1920: an updated review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "F. Guhl" 1 => "G.A. Vallejo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1590/s0074-02762003000400001" "Revista" => array:6 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2003" "volumen" => "98" "paginaInicial" => "435" "paginaFinal" => "442" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12937750" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0030" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Use of a simplified polymerase chain reaction procedure to detect Trypanosoma cruzi in blood samples from chronic chagasic patients in a rural endemic area" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "P. Wincker" 1 => "C. Britto" 2 => "J.B. Pereira" 3 => "M.A. Cardoso" 4 => "W. Oelemann" 5 => "C.M. Morel" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Am J Trop Med Hyg" "fecha" => "1994" "volumen" => "51" "paginaInicial" => "771" "paginaFinal" => "777" ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0031" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotypic Trypanosoma cruzi distribution and parasite load differ ecotypically and according to parasite genotypes in Triatoma brasiliensis from endemic and outbreak areas in Northeastern Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "C. Valença-Barbosa" 1 => "P. Finamore-Araujo" 2 => "O.C. Moreira" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Acta Trop" "fecha" => "2021" "volumen" => "222" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0032" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Detection of Trypanosoma cruzi and Trypanosoma rangeli infection in triatomine vectors by amplification of the histone H2A/SIRE and the sno-RNA-C11 genes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "P.X. Pavia" 1 => "G.A. Vallejo" 2 => "M. Montilla" 3 => "R.S. Nicholls" 4 => "C.J. Puerta" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "2007" "volumen" => "49" "paginaInicial" => "23" "paginaFinal" => "30" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0033" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dynamics of food sources, ecotypic distribution and Trypanosoma cruzi infection in Triatoma brasiliensis from the northeast of Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "M. Lilioso" 1 => "C. Reigada" 2 => "D. Pires-Silva" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "PLoS Negl Trop Dis" "fecha" => "2020" "volumen" => "14" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0034" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Secretaria da Saúde do Estado da Bahia (SESAB)/PCDCH SUVISA/DIVEP/CODTV" "autores" => array:1 [ 0 => array:2 [ "colaboracion" => "Bahia (Estado)" "etal" => false ] ] ] ] "host" => array:2 [ 0 => array:1 [ "Revista" => array:2 [ "tituloSerie" => "Situação Epidemiológica da doença de Chagas: Bahia" "fecha" => "2013" ] ] 1 => array:1 [ "WWW" => array:1 [ "link" => "https://www.saude.ba.gov.br/wp-content/uploads/2017/11/2013-Boletim-Epidemiol%C3%B3gico-Doen%C3%A7a-de-Chagas-n.-02.pdf" ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0035" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multiorganismal insects: diversity and function of resident microorganisms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A.E. Douglas" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Annu Rev Entomol" "fecha" => "2015" "volumen" => "60" "paginaInicial" => "17" "paginaFinal" => "34" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0036" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Trypanosoma cruzi: adaptation to its vectors and its hosts" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F. Noireau" 1 => "P. Diosque" 2 => "A.M. Jansen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Vet Res" "fecha" => "2009" "volumen" => "40" "paginaInicial" => "26" ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0037" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "B.B. Chomel" 1 => "H.-J. Boulouis" 2 => "E.B. Breitschwerdt" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1051/vetres/2009011" "Revista" => array:5 [ "tituloSerie" => "Vet Res" "fecha" => "2009" "volumen" => "40" "paginaInicial" => "29" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19284965" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0038" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Experimental infection of domestic cats with Bartonella henselae by inoculation of Ctenocephalides felis (Siphonaptera: pulicidae) feces" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "L. Foil" 1 => "E. Andress" 2 => "R.L. Freeland" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jmedent/35.5.625" "Revista" => array:6 [ "tituloSerie" => "J Med Entomol" "fecha" => "1998" "volumen" => "35" "paginaInicial" => "625" "paginaFinal" => "628" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9775583" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0039" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Intruders below the radar: molecular pathogenesis of Bartonella spp" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A. Harms" 1 => "C. Dehio" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CMR.05009-11" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Rev" "fecha" => "2012" "volumen" => "25" "paginaInicial" => "42" "paginaFinal" => "78" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22232371" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:2 [ "identificador" => "xack781064" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/14138670/0000002800000005/v8_202410110717/S1413867024001582/v8_202410110717/en/main.assets" "Apartado" => array:4 [ "identificador" => "10849" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/14138670/0000002800000005/v8_202410110717/S1413867024001582/v8_202410110717/en/main.pdf?idApp=UINPBA00003Y&text.app=https://bjid.org.br/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867024001582?idApp=UINPBA00003Y" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 October | 302 | 79 | 381 |
| 2024 September | 1 | 0 | 1 |
