Chronic hepatitis C (CHC) virus infection is a global disease that imposes a major global health burden. In a recently published study, the world prevalence of anti-HCV was estimated at 1.6% (1.3–2.1%), corresponding to 115 (92–149) million infections.1

Evidence suggests that the ability to control viral replication is related to viral and host factors. Several studies have demonstrated that a strong initial innate and adaptive immune response against hepatitis C virus (HCV) favors viral clearance.2–4 Thus, variation in genes involved in the immune response may contribute to the ability to clear the virus.2

In 2009, single nucleotide polymorphisms (SNP) of the IFNL3 gene (rs12979860) were related to natural clearance of HCV.3,5 According to this genome-wide study, rs12979860-CC genotype was associated with spontaneous HCV infection resolution among individuals of both European and African ancestry. Further investigations have implicated IFNL3 gene polymorphisms in the development of spontaneous resolution of acute infection and therapeutic cure of HCV-infected patients treated with interferon-based regimens.6

Before 2011, interferon-based therapy was the standard-of-care for treating HCV. Recently, interferon-free regimens based on direct-acting antivirals (DAAs) have revolutionized the treatment of CHC. Compared to conventional interferon-based regimens, DAAs have demonstrated greater sustained virological response (SVR) rates, shorter treatment duration, increased tolerability, and lower incidence of adverse events.7 Nonetheless, some patients still experience treatment failure due to on-treatment viral breakthrough or relapse after cessation of therapy, possibly attributed to unknown host and viral factors, such as IFNL3 gene polymorphism.

Toward that end, data from a recently published subgroup analysis of only eight weeks of ledipasvir plus sofosbuvir for genotype 1 HCV showed SVR rates varying significantly according to rs12979860 genotype. In rs12979860-CC genotype patients SVR rate were in excess of 98%, whereas SVR rates were 95.1% and 90.9%, in rs12979860-CT and TT genotype, respectively (p=0.02). Those results prompted discussion on the relationship of polymorphisms near the IFNL3 gene and SVR to DAA-based regimens.8

Patients of European ancestry have a significantly higher probability of being cured with interferon-based regimens than patients of African ancestry. The frequency of rs12979860-CC genotype is substantially greater in European than in African populations. This genetic polymorphism also explains approximately half of the difference in response rates between African-Americans and patients of European ancestry.5

Brazilians are one of the most heterogeneous populations in the world, resulting of five centuries of interethnic crosses between European, Africans, and autochthonous Amerindians.9 A growing number of publications have reported the use of ancestry-informative markers (AIMs) whose allele frequency varies significantly between populations of distinct geographic origins in order to estimate individual admixture and to identify population substructure. In most studies, these AIMs consisted of single-nucleotide polymorphisms (SNPs), but insertion-deletion polymorphisms (INDELs) of small DNA fragments and short tandem repeats have also been used.10–13

Thus, the objectives of the present study were to assess the prevalence of rs12979860-CC, rs12979860-CT, and rs12979860-TT genotypes of the IFNL3 gene and its relationship with ancestry markers in a Brazilian population.

Between January 2nd and July 31st 2011, 949 healthy adult blood donors were selected from the Colsan blood bank network, in São Paulo, Brazil. Of those, 420 were originally from the northeast region and 529 from the southeast region. This study was approved by Research Ethics Committee of the Federal University of São Paulo (UNIFESP).

Samples of peripheral blood from each subject were collected in 0.5M EDTA tubes, and genomic DNA was extracted from mononuclear cells using DNA blood Mini kit (QIAamp, Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's instructions.

The rs12979860 was genotyped using the ABI TaqMan SNP genotyping assays (Applied Biosystems, Foster City, CA, USA). Primers that contemplated polymorphism were IL28B_Foward: 5′ GCCTGTCGTGTACTGAACCA 3′ and IL28B_Reverse: 5′ GCGCGGAGTGCAATTCAAC 3′ (Eurofins MWG Operon, Hunstsville, AL, USA), TaqMan® MGB Probes (Applied Biosystems, Foster City, CA, USA) for each allele which were labeled with a different fluorophore: 5′ TGGTTCGCGC CTTC 3′ – VIC and 5′ CTGGTTCA CGCCTTC 3′ – FAM.5 The total reaction volume was 8.5μL containing: 1.1μL H2O; genotyping 5μL TaqMan Master Mix (Applied Biosystems, Foster City, CA); 5pM primers; 25pM probe (Applied Biosystems, Foster City, CA) and cycled in PCR machine Real® time 7500 (Applied Biosystems, Foster City, CA, USA) according to standard cycling as follows: denaturation at 95°C for 10min, followed by 40 cycles of denaturation at 92°C for 15s, annealing and extension at 60°C for 1min. The results were analyzed by using Software System 7500 (Applied Biosystems, Foster City, CA).

Genetic ancestry was determined by analyzing AIMs. DNA samples were typed for 48 biallelic INDELs using three 16-plex PCR reactions as previously described.10 DNA fragments were separated using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems) and analyzed with GeneMapper ID v3.2 software (Applied Biosystems).10

Also, at the time of blood donation participants were asked to inform their perceived race, as Caucasian or African-descendent.

Our study evaluated the link between race and polymorphisms near the IFNL3 (formerly known as IL28B) gene among healthy voluntary blood donors using AIM as a surrogate for ancestry. A total of 949 blood donors were included, 420 (44.25%) from the northeast region and 529 (55.75%) from the southeast region; 328 (34.6%) females and 621 (65.4%) males. The overall frequency of rs12979860-CC genotype was 36.9%, with a tendency for greater prevalence among donors born in the southeast (39.3%) than in the northeast (33.8%; p=0.08) regions. The average AIM of African ancestry was significantly higher among donors from the northeast region (0.279) in relation to the southeast (0.225; p<0.001), whereas the average AIM of European ancestry was significantly higher in southeast donors. The ancestry background was similar between rs12979860-CC genotype and rs12979860-CT genotype donors. African ancestry was higher among rs12979860-TT genotype donors in comparison to both rs12979860-CC genotype and rs12979860-CTdonors.

In the present study, the prevalence of rs12979860-CC, rs12979860-CT, and rs12979860-TT genotypes were 36.9%, 49.1% and 14%, respectively. The rs12979860-CC genotype in southeastern donors (39.3%) tended to be more frequent than among northeastern donors (33.8%; p=0.08). On the contrary, rs12979860-TT genotype was more prevalent in northeastern donors (17.4%) than in southeastern donors (11.3%; p=0.01). A previous Brazilian study conducted in the northeast city of Salvador, Bahia, evaluated 222 HCV infected patients and found that the prevalence of rs12979860-CC (24.4%) was lower, of rs12979860-TT (20.8%) higher, and of rs12979860-CT (54.7%) was similar to our study findings. The encountered discrepancy of rs12979860-CC and rs12979860-TT prevalence in the two studies could be due to higher representation of blacks in the Salvador study. Indeed, the self-reported prevalence of African-descendants in our study (11.4%) was much lower than that of the Salvador study (36.8%).9

A study in 88 Japanese HCV infected patients showed a prevalence of 64.3% of rs12979860-CC and 38.7% of rs12979860-CT genotypes. No rs12979860-TT genotype was encountered.14 In China, three large studies with hepatitis B infected patients found rates of rs12979860-CC genotype over 85% and rs12979860-TT genotype around 5%.14–17

In the United States, where miscegenation remains very low, the prevalence of rs12979860-TT genotype among HCV infected self-reported African descendants is significantly greater than that found in self-reported Caucasians, 37% and 12%, respectively.18 Interestingly the prevalence of rs12979860-CT genotype in Caucasians (49%) was similar to that of African descendants (51%).

Two studies conducted in Spain evaluated 283 and 119 HCV-infected patients. The rates of rs12979860-CC genotype were 44.7% and 41.1%, respectively.19,20 These rates are similar to those found in Germany (40.2%),21 but lower to the prevalence found in Egypt (54%), an intermediary value between rates found among Asians and Caucasians.22

Our results show that Brazilian adult healthy blood donors have a prevalence (36.7%) of rs12979860-CC genotype similar to that found in the US, despite its heterogeneous population mix. The prevalence of rs12979860-CT genotype was also similar to that of other western countries. However, in terms of ancestry, rs12979860-CT genotype was much closer to rs12979860-CC individuals than to rs12979860-TT. Accordingly, one could question whether the likelihood of viral clearance among rs12979860-CT Brazilian individuals is closer to that observed in rs12979860-CC than in rs12979860-TT individuals. The same would also apply for the HCV treatment response.

The overall frequency of rs12979860-TT genotype observed in our study was 14.0%, nearly the same as other western countries. In these cases, treatment failure due to on-treatment viral breakthrough or relapse after cessation of therapy may be attributed to an ineffective endogenous interferon response unable to promote viral clearance and, hence, raise the emergence of RAVs.

Despite the large sample size, our study results may not necessarily be representative for the entire Brazilian population.

Finally, the role of CT genotype in viral clearance and treatment response should be further evaluated in populations with significant and prolonged interethnic crosses such as the Brazilian population.

The authors declare no conflicts of interest.