array:24 [
  "pii" => "S1413867022000423"
  "issn" => "14138670"
  "doi" => "10.1016/j.bjid.2022.102354"
  "estado" => "S300"
  "fechaPublicacion" => "2022-05-01"
  "aid" => "102354"
  "copyright" => "Sociedade Brasileira de Infectologia"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Braz J Infect Dis. 2022;26:"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1413867022000447"
    "issn" => "14138670"
    "doi" => "10.1016/j.bjid.2022.102356"
    "estado" => "S300"
    "fechaPublicacion" => "2022-05-01"
    "aid" => "102356"
    "copyright" => "Sociedade Brasileira de Infectologia"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by/4.0/"
    "subdocumento" => "fla"
    "cita" => "Braz J Infect Dis. 2022;26:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Acceptability of self-sampling for etiological diagnosis of mucosal sexually transmitted infections &#40;STIs&#41; among transgender women in a longitudinal cohort study in S&#227;o Paulo&#44; Brazil"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0001"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1495
              "Ancho" => 2917
              "Tamanyo" => 138335
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0001"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Reasons for preferring self-collected samples for STI testing &#40;N &#61; 18&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Daniel Jason McCartney, Thiago F&#233;lix Pinheiro, Jos&#233; Luis Gomez, Paula Galdino Cardin de Carvalho, Maria Am&#233;lia Veras, Philippe Mayaud"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Daniel Jason"
              "apellidos" => "McCartney"
            ]
            1 => array:2 [
              "nombre" => "Thiago F&#233;lix"
              "apellidos" => "Pinheiro"
            ]
            2 => array:2 [
              "nombre" => "Jos&#233; Luis"
              "apellidos" => "Gomez"
            ]
            3 => array:2 [
              "nombre" => "Paula Galdino Cardin de"
              "apellidos" => "Carvalho"
            ]
            4 => array:2 [
              "nombre" => "Maria Am&#233;lia"
              "apellidos" => "Veras"
            ]
            5 => array:2 [
              "nombre" => "Philippe"
              "apellidos" => "Mayaud"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867022000447?idApp=UINPBA00003Y"
    "url" => "/14138670/0000002600000003/v1_202206230723/S1413867022000447/v1_202206230723/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S141386702200040X"
    "issn" => "14138670"
    "doi" => "10.1016/j.bjid.2022.102352"
    "estado" => "S300"
    "fechaPublicacion" => "2022-05-01"
    "aid" => "102352"
    "copyright" => "Sociedade Brasileira de Infectologia"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Braz J Infect Dis. 2022;26:"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Lung function six months after severe COVID-19&#58; Does time&#44; in fact&#44; heal all wounds&#63;"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0001"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1450
              "Ancho" => 1542
              "Tamanyo" => 193128
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "alt0001"
              "detalle" => "Fig "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Flow Chart&#58; patients evaluated between May 23rd 2020 and January 5th 2021&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Daniel Cruz Bretas, Arnaldo Santos Leite, Eliane Viana Mancuzo, Tarciane Aline Prata, Bruno Horta Andrade, Jacqueline das Gra&#231;as Ferreira Oliveira, Aline Priscila Batista, George Luiz Lins Machado-Coelho, Val&#233;ria Maria Augusto, Carolina Coimbra Marinho"
          "autores" => array:10 [
            0 => array:2 [
              "nombre" => "Daniel Cruz"
              "apellidos" => "Bretas"
            ]
            1 => array:2 [
              "nombre" => "Arnaldo Santos"
              "apellidos" => "Leite"
            ]
            2 => array:2 [
              "nombre" => "Eliane Viana"
              "apellidos" => "Mancuzo"
            ]
            3 => array:2 [
              "nombre" => "Tarciane Aline"
              "apellidos" => "Prata"
            ]
            4 => array:2 [
              "nombre" => "Bruno Horta"
              "apellidos" => "Andrade"
            ]
            5 => array:2 [
              "nombre" => "Jacqueline das Gra&#231;as Ferreira"
              "apellidos" => "Oliveira"
            ]
            6 => array:2 [
              "nombre" => "Aline Priscila"
              "apellidos" => "Batista"
            ]
            7 => array:2 [
              "nombre" => "George Luiz Lins"
              "apellidos" => "Machado-Coelho"
            ]
            8 => array:2 [
              "nombre" => "Val&#233;ria Maria"
              "apellidos" => "Augusto"
            ]
            9 => array:2 [
              "nombre" => "Carolina Coimbra"
              "apellidos" => "Marinho"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S141386702200040X?idApp=UINPBA00003Y"
    "url" => "/14138670/0000002600000003/v1_202206230723/S141386702200040X/v1_202206230723/en/main.assets"
  ]
  "en" => array:18 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "The expression patterns of MALAT-1&#44; NEAT-1&#44; THRIL&#44; and miR-155-5p in the acute to the post-acute phase of COVID-19 disease"
    "tieneTextoCompleto" => true
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Mohammad Abbasi-Kolli, Javid Sadri Nahand, Seyed Jalal Kiani, Khadijeh Khanaliha, AliReza Khatami, Mohammad Taghizadieh, Ali Rajabi Torkamani, Kimiya Babakhaniyan, Farah Bokharaei-Salim"
        "autores" => array:9 [
          0 => array:3 [
            "nombre" => "Mohammad"
            "apellidos" => "Abbasi-Kolli"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0001"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Javid"
            "apellidos" => "Sadri Nahand"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0002"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Seyed Jalal"
            "apellidos" => "Kiani"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0003"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Khadijeh"
            "apellidos" => "Khanaliha"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0004"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "AliReza"
            "apellidos" => "Khatami"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0003"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Mohammad"
            "apellidos" => "Taghizadieh"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Ali Rajabi"
            "apellidos" => "Torkamani"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0006"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Kimiya"
            "apellidos" => "Babakhaniyan"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0007"
              ]
            ]
          ]
          8 => array:4 [
            "nombre" => "Farah"
            "apellidos" => "Bokharaei-Salim"
            "email" => array:1 [
              0 => "bokharaei.f@iums.ac.ir"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0003"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0001"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:7 [
          0 => array:3 [
            "entidad" => "Iran University of Medical Sciences&#44; Deputy of Health&#44; Tehran&#44; Iran"
            "etiqueta" => "a"
            "identificador" => "aff0001"
          ]
          1 => array:3 [
            "entidad" => "Tabriz University of Medical Sciences&#44; Infectious and Tropical Diseases Research Center&#44; Tabriz&#44; Iran"
            "etiqueta" => "b"
            "identificador" => "aff0002"
          ]
          2 => array:3 [
            "entidad" => "Iran University of Medical Sciences&#44; School of Medicine&#44; Department of Virology&#44; Tehran&#44; Iran"
            "etiqueta" => "c"
            "identificador" => "aff0003"
          ]
          3 => array:3 [
            "entidad" => "University of Medical Sciences&#44; Institute of Immunology and Infectious Diseases&#44; Research Center of Pediatric Infectious Diseases&#44; Tehran&#44; Iran"
            "etiqueta" => "d"
            "identificador" => "aff0004"
          ]
          4 => array:3 [
            "entidad" => "Tabriz University of Medical Sciences&#44; Center for Women&#39;s Health Research Zahra&#44; School of Medicine&#44; Department of Pathology&#44; Tabriz&#44; Iran"
            "etiqueta" => "e"
            "identificador" => "aff0005"
          ]
          5 => array:3 [
            "entidad" => "Tehran University of Medical Sciences&#44; School of Medicine&#44; Department of Clinical Biochemistry&#44; Tehran&#44; Iran"
            "etiqueta" => "f"
            "identificador" => "aff0006"
          ]
          6 => array:3 [
            "entidad" => "Iran University of Medical Sciences&#44; School of Nursing and Midwifery&#44; Department of Medical Surgical Nursing&#44; Tehran&#44; Iran"
            "etiqueta" => "g"
            "identificador" => "aff0007"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0001"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2297
            "Ancho" => 1542
            "Tamanyo" => 227019
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">ROC analysis for evaluating the diagnostic ability of ncRNAs to discriminate SARS-CoV-2 infected group from uninfected groups &#40;AUC&#44; Area Under the Curve&#59; P&#44; p-value&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0007">Introduction</span><p id="para0005" class="elsevierStylePara elsevierViewall">The Coronavirus Disease Pandemic of 2019 &#40;COVID-19&#41; is caused by a novel coronavirus known as Severe Acute Respiratory Syndrome Coronavirus 2 &#40;SARS-CoV-2&#41;&#46; At the moment&#44; 239 million individuals have been infected with SARS-CoV-2&#44; and much more than 4&#46;8 million have died as a result of this infection&#46;<a class="elsevierStyleCrossRef" href="#bib0001"><span class="elsevierStyleSup">1</span></a> In addition&#44; the epidemic has triggered worldwide social and economic instability&#46; SARS-CoV-2 is an enveloped virus with a positive non-segmented single-stranded RNA genome which belongs to <span class="elsevierStyleItalic">Nidovirales</span> order&#44; <span class="elsevierStyleItalic">Coronaviridae</span> family&#44; <span class="elsevierStyleItalic">Betacoronavirus</span> genus&#44; and lineage B&#46;<a class="elsevierStyleCrossRef" href="#bib0002"><span class="elsevierStyleSup">2</span></a> Because of the worldwide severity of the pathogen&#44; the increased infection rate of SARS-CoV-2&#44; and the limitation of effective treatment approaches&#44; more research is needed to properly control their spread and to offer treatment alternatives&#46;</p><p id="para0006" class="elsevierStylePara elsevierViewall">Over than 90&#37; of the human DNA sequence is constantly transcribed&#44; but only 2&#37; of it produces proteins&#46; The vast majority of transcripts are classified as non-coding RNAs &#40;ncRNAs&#41;&#46; According to their sequence length&#44; ncRNAs are classified into long non-coding RNA &#40;lncRNA&#41; with size larger than 200 nucleotides &#40;nt&#41; and small non-coding RNA &#40;sncRNA&#41; with length less than 200 nt&#44; such as microRNAs&#44; which are both important epigenetic and sub-cellular regulatory elements that can be involved in complex cellular biological processes&#46;<a class="elsevierStyleCrossRef" href="#bib0003"><span class="elsevierStyleSup">3</span></a> Reportedly&#44; lncRNAs may play essential regulatory functions in the interaction between virus and host&#44; including regulation of host antiviral responses&#44; direct and indirect roles in viral and host gene transcription&#44; as well as regulation of the stability and translation of mRNAs&#46;<a class="elsevierStyleCrossRef" href="#bib0004"><span class="elsevierStyleSup">4</span></a> Also&#44; it has been found that viral proteins can influence the expression level of cellular lncRNAs and microRNAs &#40;miRNAs&#41;&#46; As a result&#44; changes in the expression level of these factors&#44; directly and&#47;or indirectly&#44; can affect viral infection through regulating host innate immune responses&#44; such as inflammation&#44; and by regulating expression of both cellular and viral genes&#46;<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">5-7</span></a></p><p id="para0007" class="elsevierStylePara elsevierViewall">MicroRNA-155-5p &#40;miR-155-5p&#41; has been characterized as an ancient immune cell regulator&#46; MiR-155-5p is remarkable in the immune system because it can change the transcription of activated myeloid and lymphoid cells&#44; regulating a wide range of biological processes from inflammation to immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0008"><span class="elsevierStyleSup">8</span></a> Numerous research in recent years have demonstrated that miR-155-5p is evolutionarily conserved&#46; Its expression is continuously increased in diverse cellular systems during viral infections in both animal and human models&#46;<a class="elsevierStyleCrossRef" href="#bib0009"><span class="elsevierStyleSup">9</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">10</span></a> Similarly&#44; in animal models of Acute Respiratory Distress Syndrome &#40;ARDS&#41;&#44; increased miR-155-5p is associated with respiratory infections&#44; illness severity&#44; and greater mortality&#46;<a class="elsevierStyleCrossRef" href="#bib0011"><span class="elsevierStyleSup">11</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0012"><span class="elsevierStyleSup">12</span></a> Overall&#44; evidence strongly suggests that miR-155 has a critical role as regulator of inflammation<a class="elsevierStyleCrossRef" href="#bib0013"><span class="elsevierStyleSup">13</span></a> and during most viral infections&#44; since the expression level of miR-155 is upregulated and regulates antiviral immune responses&#46;<a class="elsevierStyleCrossRef" href="#bib0014"><span class="elsevierStyleSup">14</span></a></p><p id="para0008" class="elsevierStylePara elsevierViewall">Nuclear Factor-kappa B &#40;NF-&#954;B&#41; is a dimeric transcription factor involved in inflammation and has an important role in pathogenesis of several inflammatory disease such as Chronic Obstructive Pulmonary Disease &#40;COPD&#41; and COVID-19&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">15</span></a> Numerous ncRNAs such as miR-155-5p&#44; MALAT-1&#44; NEAT-1 and THRIL are involved in regulating the NF-&#954;B signaling pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0016"><span class="elsevierStyleSup">16</span></a> It has been reported that lncRNA MALAT-1 can control cytokine secretion in macrophages under inflammatory circumstances and promote inflammatory activity by interacting with the NF-&#954;B signaling pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0017"><span class="elsevierStyleSup">17</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0018"><span class="elsevierStyleSup">18</span></a> NEAT-1 is another lncRNA that has been shown to play a role in NF-&#954;B signaling pathway and NEAT-1 inhibition prevented the activation of the NF-&#954;B pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0019"><span class="elsevierStyleSup">19</span></a> and induced expression of inflammatory-related cytokines such as IL-8 and IL-6&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">20</span></a> Reportedly&#44; NEAT-1 probably can help the inflammation-regulating ncRNA-mRNA network&#44; and some factors linked with this network may be able to regulate inflammation by interacting with essential inflammatory mediators such as IL-6&#44; TNF and muscarinic acetylcholine receptors&#46;<a class="elsevierStyleCrossRefs" href="#bib0021"><span class="elsevierStyleSup">21-23</span></a> THRIL is a newly described lncRNA that has been confirmed to interact with hnRNPL &#40;Heterogeneous Nuclear Ribonucleoprotein L&#41; and then controlling the expression of TNF-&#945; with an important role in regulation of inflammation and immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0024"><span class="elsevierStyleSup">24</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">25</span></a> THRIL induce the upregulation of NRP1 expression and further induce the modulation of the NF-&#954;B signaling pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0026"><span class="elsevierStyleSup">26</span></a> As a result&#44; the interaction between lncRNAs and targets &#40;e&#46;g&#46;&#44; miRNAs&#44; cellular factors and viral genes&#41; has sparked researchers&#39; interests to investigate the potential biomarkers and&#47;or therapeutic targets&#46; Currently&#44; our understanding of SARS-CoV-2 processes is limited&#44; and there are no particular biomarkers associated with SARS-CoV-2 diagnosis or therapy&#46; Since selected cellular ncRNAs &#40;miR-155-5p&#44;<a class="elsevierStyleCrossRefs" href="#bib0027"><span class="elsevierStyleSup">27-31</span></a> MALAT-1&#44;<a class="elsevierStyleCrossRefs" href="#bib0032"><span class="elsevierStyleSup">32-35</span></a> NEAT-1<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">20</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0036"><span class="elsevierStyleSup">36</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0037"><span class="elsevierStyleSup">37</span></a> and THRIL<a class="elsevierStyleCrossRef" href="#bib0038"><span class="elsevierStyleSup">38</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0039"><span class="elsevierStyleSup">39</span></a>&#41; may play critical roles in immune response regulation and inflammation&#44; we evaluated the expression pattern of lncRNAs &#40;MALAT-1&#44; NEAT-1 and THRIL&#41; and miR-155-5p in Peripheral Blood Mononuclear Cells &#40;PBMC&#41; of SARS-CoV-2 infected individuals in both acute and post-acute stages and compared to healthy individuals&#46;</p></span><span id="sec0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0008">Patients and methods</span><span id="sec0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0009">Patients&#8217; selection</span><p id="para0009" class="elsevierStylePara elsevierViewall">From June 2021 to July 2021&#44; 20 patients with COVID-19 infection were recruited from the West Health Center in Tehran &#40;related to Iran University of Medical Sciences &#91;IUMS&#93;&#41; and enrolled in this cross-sectional survey&#46; A peripheral blood sample of 6 mL was collected from these patients during the acute phase and again in the post-acute phase&#44; and from 20 healthy controls&#46;</p><p id="para0010" class="elsevierStylePara elsevierViewall">It should be noted that the studied participants did not have co-infections with Human Immunodeficiency Virus &#40;HIV&#41;&#44; Human Cytomegalovirus &#40;HCMV&#41;&#44; Hepatitis B Virus &#40;HBV&#41;&#44; and Hepatitis C Virus &#40;HCV&#41;&#44; and <span class="elsevierStyleItalic">Mycobacterium tuberculosis</span>&#46; Furthermore&#44; none of the subjects had underlying medical conditions&#46;</p></span><span id="sec0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0010">Ethical issues</span><p id="para0011" class="elsevierStylePara elsevierViewall">This study was approved by the ethics committee of IUMS &#40;ethical code&#58; IR&#46; IUMS&#46; REC&#46;1400&#46;381&#41;&#44; and all of the participants filled written informed consent for blood specimen collection&#46;</p></span><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0011">Preparation of peripheral blood mononuclear cells &#40;PBMCs&#41;</span><p id="para0012" class="elsevierStylePara elsevierViewall">Collected peripheral blood from each subject was transferred into a tube containing Ethylenediaminetetraacetic Acid &#40;EDTA&#41; as anticoagulant and then separated by centrifugation&#46; PBMCs were isolated based on the ficoll hypaque density gradient centrifugation &#40;Lympholyte-H&#44; Cedarlane&#44; Hornby&#44; Canada&#41; technique according to the manufacturer&#39;s instructions&#44; and then the pellet of PBMCs was washed three times with phosphate-buffered saline &#40;pH&#58; 7&#46;3&#177;0&#46;1&#41;&#44; and finally re-suspended with 350 &#181;L of RNA maintenance solution &#40;RNA-Later &#91;Ambion&#44; Inc&#46;&#44; Austin&#44; TX&#93;&#41;&#44; and kept at -80&#176;C until extraction of the total RNA&#46;</p></span><span id="sec0006" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0012">Total RNA isolation and complementary DNA &#40;cDNA&#41; synthesis</span><p id="para0013" class="elsevierStylePara elsevierViewall">Total RNA was extracted from PBMC samples according to the manufacturer&#39;s protocols with minor modifications&#46; Briefly&#44; after PBMC lysis with 1 mL QIAzol solution&#44; 250 &#956;L of chloroform was added to the lysate&#44; shaken vigorously for one minute&#44; and after 5&#8210;10 minutes of incubation at room temperature&#44; centrifuged at 12&#44;000&#160;&#215;&#160;g for 15 minutes at 4&#176;C&#46;The supernatant was aspirated and approximatel 800 &#956;l isopropanol was added and placed in the freezer overnight&#46; The samples were centrifuged at 12&#44;000&#160;&#215;&#160;g for 45 minutes at 4&#176;C&#46; One mL ethanol &#40;100&#37;&#41; was added to the RNA pellet and the microtubes went up and down several times and centrifuged at 12&#44;000&#160;&#215;&#160;g for 15 minutes at 4&#176;C&#46; The pellet of RNA was air-dried and dissolved with RNase&#47;DNase free distilled water&#46; The integrity and purity of the isolated RNA was evaluated using a Nano-Drop spectrophotometer &#40;Thermo Scientific&#44; Wilmington&#44; MA&#41; instrument&#44; and then kept at -80&#176;C until the test&#46;</p><p id="para0014" class="elsevierStylePara elsevierViewall">To determine the expression pattern of lncRNAs &#40;MALAT-1&#44;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">40</span></a> NEAT-1<a class="elsevierStyleCrossRef" href="#bib0041"><span class="elsevierStyleSup">41</span></a> and THRIL&#44;<a class="elsevierStyleCrossRef" href="#bib0042"><span class="elsevierStyleSup">42</span></a>&#41;&#44; as well as GAPDH and &#946;-actin &#40;as normalization controls for relative quantification&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0042"><span class="elsevierStyleSup">42</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0043"><span class="elsevierStyleSup">43</span></a> cDNA was synthesized using 350 ng of the total RNA as previously described in detail&#46;<a class="elsevierStyleCrossRef" href="#bib0044"><span class="elsevierStyleSup">44</span></a></p></span><span id="sec0007" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0013">Expression analysis of genes using real-time PCR</span><p id="para0015" class="elsevierStylePara elsevierViewall">The expression patterns of lncRNAs &#40;MALAT-1&#44;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">40</span></a> NEAT-1<a class="elsevierStyleCrossRef" href="#bib0041"><span class="elsevierStyleSup">41</span></a> and THRIL<a class="elsevierStyleCrossRef" href="#bib0042"><span class="elsevierStyleSup">42</span></a>&#41;&#44; and also GAPDH &#40;the expression level of this housekeeping gene was considered as reference gene&#41;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">45</span></a> were determined by real-time Polymerase Chain Reaction &#40;PCR&#41; using a Rotorgene Q thermal cycler &#40;Qiagen&#44; Hilden&#44; Germany&#41; instrument&#46; The assays were done on 20 &#956;L reaction mixture including&#58; 10 pmol of each primer &#40;MALAT-1&#44; NEAT-1&#44; THRIL&#44; GAPDH and &#946;-actin&#41;&#44; 8 &#956;L nuclease free distilled water&#44; 10 &#956;L 2&#160;&#215;&#160;SYBR&#174; Premix Ex Taq &#40;Tli Plus&#41; Master Mix &#40;TaKaRa Bio Inc&#46; Shiga&#44; Japan&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0001">Table 1</a>&#41; and one &#956;L of cDNA as template&#46;</p><elsevierMultimedia ident="tbl0001"></elsevierMultimedia><p id="para0016" class="elsevierStylePara elsevierViewall">The thermocycling conditions for real-time PCR were defined as follows&#58; initial denaturing at 95&#176;C for 15 minutes&#44; and 40 cycles&#44; including 15 seconds at 95&#176;C&#44; 30 seconds at 60&#176;C&#44; and 20 seconds at 72&#176;C&#46; The 2<span class="elsevierStyleSup">&#8722;&#916;&#916;CT</span> method was used for calculation of the relative expression values&#46; All the specimens were tested in duplicate reactions&#46;</p></span><span id="sec0008" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0014">miRNA-155-5p expression analysis</span><p id="para0017" class="elsevierStylePara elsevierViewall">Total RNA was extracted &#40;as described in the previous section&#41; from PBMC samples&#46; Complementary DNA &#40;cDNA&#41; was synthesized using 5 &#956;g of the total RNA as previously described in detail&#46;<a class="elsevierStyleCrossRef" href="#bib0046"><span class="elsevierStyleSup">46</span></a> In the current study the expression of miR-155-5p was evaluated in PBMC specimens of SARA-CoV-2 infected patients in the two stages of disease &#40;acute and post-acute phase&#41; and of healthy controls based on available information&#46;</p><p id="para0018" class="elsevierStylePara elsevierViewall">The real time PCR assay was carried out in final 20 &#956;L volume&#44; including 0&#46;5 &#956;L of specific forward primer&#44; 0&#46;5 &#956;L of universal reverse primer&#44; 10 &#956;L of SYBR Green PCR Master Mix &#40;TaKaRa&#44; Kusatsu&#44; Japan&#41;&#44; 8 &#956;L of nuclease-free water&#44; and one &#956;L of cDNA as template&#46; The thermal profile of this assay &#40;three steps with melt&#41; was set at 95&#176;C for two minutes as hold time&#44; followed by 40 cycles of denaturation at 95&#176;C for 15 seconds&#44; annealing at 60&#176;C for 20 seconds&#44; and extension at 72&#176;C for 25 seconds&#44; and also melting curve analysis was determined at temperatures ranging from 55 to 99&#176;C&#46; This assay was performed using the Rotorgene Q thermal cycler &#40;Qiagen&#44; Hilden&#44; Germany&#41; instrument&#46; The expression levels of miR-155-5p was normalized to Snord47 and 68 as reference RNA and the fold change was calculated by the Livak method&#46;<a class="elsevierStyleCrossRef" href="#bib0047"><span class="elsevierStyleSup">47</span></a> It should be noted that all reactions were done in triplicate&#46;</p></span><span id="sec0009" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0015">Statistical analysis</span><p id="para0019" class="elsevierStylePara elsevierViewall">Data were analyzed using SPSS version 16 &#40;SPSS Inc&#46;&#44; Chicago&#44; IL&#44; USA&#41; and Prism 6&#46;0 software &#40;GraphPad&#44; San Diego&#44; CA&#44; USA&#41;&#46; Clinical and demographics characteristics were presented as n &#40;&#37;&#41; for categorical variables and mean &#177; Standard Deviations &#40;SD&#41; for age&#44; which were analyzed by Fisher&#39;s exact test and Student <span class="elsevierStyleItalic">t</span>-Test&#44; respectively&#46; The Mann-Whitney <span class="elsevierStyleItalic">U</span>-test or the independent-samples <span class="elsevierStyleItalic">t</span>-test was used to compare the mean expression levels of ncRNAs &#40;MALAT-1&#44; NEAT-1&#44; THRIL and miR-155-5p&#41; between the COVID-19 groups with the healthy control group&#46; The statistical difference of the mean level of ncRNAs between acute and post-acute phases of COVID-19 disease was compared using the paired sample <span class="elsevierStyleItalic">t</span>-test&#46; The Receiver Operating Characteristic &#40;ROC&#41; curve analysis was performed to evaluate the diagnostic value of ncRNA expression level in discriminating between study groups&#46; The Spearman rank correlation was used to compare the association of variables&#46; The Benjamini and Hochberg procedure was used to control for the false discovery rate&#46; All statistical evaluations were two-tailed&#44; and p-values less than 0&#46;05 were considered significant&#46;</p></span></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0016">Results</span><span id="sec0011" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0017">Characteristics of participants</span><p id="para0020" class="elsevierStylePara elsevierViewall">Fifty SARS-CoV-2 infected patients &#40;in both acute and post-acute phases of the disease&#41; and 50 healthy individuals were enrolled in this cross-sectional study&#46; These two studied groups were matched for sex and age&#46; The mean age of studied patients with SARS CoV-2 infection was 36&#46;1&#177;10&#46;9 &#40;ranging between 22&#8210;67 years&#41; and for healthy individuals was 36&#46;2&#177;12&#46;1 &#40;ranging between 23&#8210;67 years&#41;&#46; The demographic parameters of the studied participants and clinical manifestations of patients with SARS-CoV-2 infection are summarized in <a class="elsevierStyleCrossRef" href="#tbl0002">Table 2</a>&#46;</p><elsevierMultimedia ident="tbl0002"></elsevierMultimedia></span><span id="sec0012" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0018">Expression pattern of ncRNAs was significantly deregulated during COVID-19 disease</span><p id="para0021" class="elsevierStylePara elsevierViewall">The expression level of MALAT-1&#44; NEAT-1&#44; THRIL&#44; and miR-155-5p were examined in PBMC samples during acute and post-acute COVID-19 disease and healthy control subjects&#46; In acute COVID-19 group&#44; expression profiles of MALAT-1&#44; THRIL and miR-155-5P were found significantly deregulated &#40;p-value of &#60; 0&#46;05&#41; when compared with healthy controls&#46; In comparison to the control group&#44; the acute COVID-19 group showed higher expression levels&#58; 3&#46;42-fold for the miR-155-5p&#44; 2&#46;27-fold for THRIL&#44; and 2&#46;12-fold for MALAT-1&#44; respectively&#46; Also&#44; there was no significant difference in the mean expression level of NEAT-1 between acute COVID-19 group and control group &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>A&#41;&#44; &#40;p-value &#62; 0&#46;05&#41;&#46; The expression pattern of lncRNAs &#40;MALAT-1&#44; NEAT-1 and THRIL&#41; in post-acute COVID-19 group was similar to the healthy control group&#44; as shown in <a class="elsevierStyleCrossRef" href="#fig0001">Figure 1</a>A&#46; However&#44; the mean expression level of miR-155-5p in post-acute COVID-19 was higher than that of control subjects &#40;2&#46;49-fold change&#44; p-value &#60; 0&#46;0001&#41;&#46;</p><elsevierMultimedia ident="fig0001"></elsevierMultimedia><p id="para0022" class="elsevierStylePara elsevierViewall">In order to identify a PBMC biomarker that could be applicable to distinguish the prognosis of COVID-19 disease&#44; the PBMC level of the selected lncRNAs &#40;MALAT-1&#44; NEAT-1 and THRIL&#41; and miR-155-5p were re-measured 6&#8210;5 weeks after the acute phase of COVID-19&#46; Mean expression level of MALAT-1 and THRIL were significantly down-regulated &#40;-1&#46;8-fold&#44; p-value&#160;&#61;&#160;0&#46;037 and -1&#46;98-fold&#44; p-value&#160;&#61;&#160;0&#46;022&#44; respectively&#41; in post-acute phase of COVID-19 compared to acute phase of COVID-19 disease &#40;<a class="elsevierStyleCrossRef" href="#fig0001">Fig&#46; 1</a>B&#41;&#46; However&#44; there was no significant difference in the expression pattern of miR-155-5p&#44; and THRIL between acute COVID-19 group and post-acute COVID-19 group &#40;p-value &#62; 0&#46;05&#41;&#46;</p><p id="para0023" class="elsevierStylePara elsevierViewall">In the current study&#44; the potential of ncRNAs &#40;miR-155-5p&#44; MALAT-1&#44; NEAT-1 and THRIL&#41; in discriminating between COVID-19 groups and healthy controls and between acute phase of COVID-19 and post-acute phase of COVID-19 was evaluated by the ROC curve analysis&#46; According to results which are illustrated in <a class="elsevierStyleCrossRef" href="#fig0002">Figure 2</a>&#44; miR-155-5p &#40;AUC&#160;&#61;&#160;0&#46;89&#44; p-value &#60; 0&#46;0001&#41;&#44; MALAT-1 &#40;AUC&#160;&#61;&#160;0&#46;81&#44; p-value &#60; 0&#46;0001&#41; and THRIL &#40;AUC&#160;&#61;&#160;0&#46;77&#44; p-value&#160;&#61;&#160;0&#46;003&#41; are effective in distinguishing acute phase of COVID-19 from healthy controls&#46; In the case of post-acute COVID-19 phase compared with healthy controls&#44; the AUC value for miR-155-5p was 0&#46;83 &#40;p-value &#60; 0&#46;0001&#41;&#46; Especially&#44; the miR-155-5p showed an excellent AUC value&#46; Lastly&#44; PBMC THRIL and MALAT-1 were able to distinguish acute phase of COVID-19 from post-acute phase of COVID-19 disease with AUC value of 0&#46;75 &#40;p-value&#160;&#61;&#160;0&#46;005&#41; and 0&#46;72 &#40;p-value&#160;&#61;&#160;0&#46;021&#41;&#44; respectively &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a>&#41;&#46;</p><elsevierMultimedia ident="fig0002"></elsevierMultimedia></span><span id="sec0013" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0019">The correlation between clinical characteristics and relative expressions of ncRNAs</span><p id="para0024" class="elsevierStylePara elsevierViewall">Hsa-miR-155-5p is one of the cellular miRNAs that maybe play a critical role in regulating inflammation and antiviral cellular defense in SARS-CoV-2 infection&#46;<a class="elsevierStyleCrossRef" href="#bib0048"><span class="elsevierStyleSup">48</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0049"><span class="elsevierStyleSup">49</span></a> Furthermore&#44; it has been documented that some cellular lncRNAs&#44; such as MALAT-1&#44; cause modulating miR-155-5p expression&#46;<a class="elsevierStyleCrossRef" href="#bib0049"><span class="elsevierStyleSup">49</span></a> For this reason&#44; to determine the correlation between the expression level of lncRNAs &#40;MALAT-1&#44; NEAT-1 and THRIL&#41; and miR-155-5p&#44; Spearman correlation analysis was performed&#46; According to the result&#44; a negative correlation was found between MALAT-1 level and level of miR-155-5p &#40;r&#160;&#61;&#160;-0&#46;52&#44; p-value &#60; 0&#46;0001&#41;&#44; &#40;<a class="elsevierStyleCrossRef" href="#fig0003">Fig&#46; 3</a>A&#41;&#46; However&#44; there was no significant correlation between expression level of NEAT-1 and THRIL with miR-155-5p expression level &#40;<a class="elsevierStyleCrossRef" href="#fig0002">Fig&#46; 2</a> B and C&#41;&#46;</p><elsevierMultimedia ident="fig0003"></elsevierMultimedia><p id="para0025" class="elsevierStylePara elsevierViewall">To investigate the relationship among expression level of ncRNAs with demographic-clinical characteristics and by SARS-CoV-2 &#40;RdRP and N&#41; genes in the COVID-19 patients during acute COVID-19 disease&#44; Spearman correlation coefficient was carried out &#40;<a class="elsevierStyleCrossRef" href="#tbl0003">Table 3</a>&#41;&#46; According to the result&#44; there was a significant negative correlation between delta Ct of miR-155-5p and delta Ct of RdRp &#40;r&#160;&#61;&#160;-0&#46;7&#44; p-value &#60; 0&#46;001&#41; and N genes &#40;r&#160;&#61;&#160;-0&#46;61&#44; p-value &#60; 0&#46;01&#41; of SARS-Cov-2&#46; Besides&#44; a significant positive correlation was found among delta Ct of THRIL and NEAT-1 with dry cough &#40;r&#160;&#61;&#160;0&#46;57&#44; and r&#160;&#61;&#160;0&#46;46&#44; respectively&#41; and with sputum cough &#40;r&#160;&#61;&#160;0&#46;42 and r&#160;&#61;&#160;0&#46;58&#44; respectively&#41;&#46; As well&#44; a significant positive correlation was found between MALAT-1 and fever &#40;r&#160;&#61;&#160;0&#46;61&#44; p-value &#60; 0&#46;001&#41;&#44; skeletal pain &#40;r&#160;&#61;&#160;0&#46;55&#44; p-value &#60; 0&#46;01&#41; More information is provided in <a class="elsevierStyleCrossRef" href="#tbl0003">Table 3</a>&#46;</p><elsevierMultimedia ident="tbl0003"></elsevierMultimedia></span></span><span id="sec0014" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0020">Discussion</span><p id="para0026" class="elsevierStylePara elsevierViewall">Increasing evidence indicated that ncRNAs play a critical role in inflammation-related disorders by regulation of the diverse biological processes&#44; such as the activation of inflammatory pathway signaling&#46;<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">50</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0051"><span class="elsevierStyleSup">51</span></a> Reportedly&#44; ncRNAs cross-talking with immune cells can also regulate inflammation and immunological response&#46; Further&#44; due to growing understanding of the interactions between SARS-CoV-2 with host ncRNAs&#44;<a class="elsevierStyleCrossRef" href="#bib0052"><span class="elsevierStyleSup">52</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0053"><span class="elsevierStyleSup">53</span></a> one could suggest that SARS-CoV-2 can alter the immunological pathway by deregulation of ncRNAs expression&#46; Result of this research point out that the expression level of MALAT-1&#44; NEAT-1&#44; THRIL&#44; and miR-155-5p&#44; which are associated with inflammatory response&#44; were significantly different between COVID-19 patients and healthy control subjects&#44; as well as between acute and post-acute phase of COVID-19 disease&#46; Recently&#44; it was shown that expression level of MALAT-1 was significantly upregulated in SARS-CoV-2-infected bronchial epithelial cells&#46;<a class="elsevierStyleCrossRef" href="#bib0054"><span class="elsevierStyleSup">54</span></a> In another study&#44; Huang et&#160;al&#46;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">55</span></a> reported that expressions of NEAT-1 and MALAT-1 were significantly increased in severe COVID-19 patients compared to mild COVID-19 patients and they suggested that NEAT-1 and MALAT-1 promote cellular damage and stress&#46;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">55</span></a> In addition&#44; an <span class="elsevierStyleItalic">in vivo</span> study reported that silencing MALAT-1 inhibited neutrophil chemotaxis by interleukin-8 and suppresses pulmonary epithelial cells apoptosis&#46;<a class="elsevierStyleCrossRef" href="#bib0056"><span class="elsevierStyleSup">56</span></a> All of these findings suggest that MALAT-1 is increased in lung cells of COVID-19 patients&#44; promoting immune cell taxi and subsequent harmful inflammation&#46; MALAT-1 expression is also linked to macrophage activation and maturation into the M1 subtype&#44; which is important in numerous pathological events&#44; including inflammation&#46;<a class="elsevierStyleCrossRef" href="#bib0057"><span class="elsevierStyleSup">57</span></a> Besides&#44; MALAT-1 can promote the expression of Maf and IL-10 in T-helper &#40;Th&#41; cells and eventually suppresses immunity against infection&#46;<a class="elsevierStyleCrossRef" href="#bib0058"><span class="elsevierStyleSup">58</span></a> Recently&#44; Rodrigues et&#160;al&#46;<a class="elsevierStyleCrossRef" href="#bib0059"><span class="elsevierStyleSup">59</span></a> investigated the expression of miR-3142&#44; MALAT-1&#44; and NEAT-1 in nasopharyngeal swab and saliva specimens of COVID-19 patients&#46; They observed that expression levels of the NEAT-1 and MALAT-1 in SARS-CoV-2 positive samples were higher than those of healthy controls&#46; Further&#44; they suggested that salivary NEAT-1 could act as a potential biomarker for distinguishing between healthy subjects from COVID-19 patients &#40;AUC&#160;&#61;&#160;0&#46;80&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0059"><span class="elsevierStyleSup">59</span></a> Similarly&#44; our data reveal that the level of MALAT-1 was significantly overexpressed in the acute phase of COVID-19 disease compared to healthy subjects&#46; However&#44; the expression level of MALAT-1 was significantly decreased from the acute phase to the post-acute phase of COVID-19 disease&#46;</p><p id="para0027" class="elsevierStylePara elsevierViewall">NEAT-1&#44; a pro-inflammatory lncRNA which is comparable genomically to MALAT-1&#44; was found to increase inflammation through enhanced inflammasome assembly and processing&#46;<a class="elsevierStyleCrossRef" href="#bib0060"><span class="elsevierStyleSup">60</span></a> NEAT-1 promote inflammation by induction of inflammatory cytokines such as Interleukin-6 &#40;IL-6&#41;&#46; In response to SARS-CoV-2 infection&#44; IL-6 is one of the key immune components&#46;<a class="elsevierStyleCrossRef" href="#bib0059"><span class="elsevierStyleSup">59</span></a> In nine cell types &#40;M1 and M2 type macrophages&#44; monocytes&#44; CD4&#43; T cells&#44; and CD8&#43; memory T cells&#41; identified from severe COVID-19 patient Bronchoalveolar Lavage &#40;BAL&#41; samples&#44; there was overexpression of NEAT-1&#46;<a class="elsevierStyleCrossRef" href="#bib0061"><span class="elsevierStyleSup">61</span></a> According to our findings&#44; no significant difference was observed in PBMC level of NEAT-1 between the acute COVID-19 group and the control group&#44; and also the mean expression level of NEAT-1 during the acute phase of COVID-19 was statistically similar to the post-acute phase of the disease&#46; These results suggest that the immunological effect of NEAT-1 may be specific to the lung&#44; i&#46;e&#46;&#44; where the infection and inflammation initiate&#46; Besides&#44; different results from previous studies were possible because of differences in the type of samples&#46;</p><p id="para0028" class="elsevierStylePara elsevierViewall">The lncRNA THRIL can be involved in immune response to viral infection largely through regulating TNF-&#945;&#44; IFN-&#946;&#44; IL8 expression and inflammatory response&#46;<a class="elsevierStyleCrossRef" href="#bib0062"><span class="elsevierStyleSup">62</span></a> Tumor Necrosis Factor &#40;TNF&#41;&#44; an activator of NF-&#954;B signaling pathway&#44; is a major inflammatory cytokine regulator in host defense against viral infection&#46;<a class="elsevierStyleCrossRef" href="#bib0063"><span class="elsevierStyleSup">63</span></a> THRIL directly modulates TNF-&#945;&#44; whereas THRIL induces other cytokines and chemokines&#44; but the processes need to be further investigated&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">25</span></a> For the first time in this study&#44; we explored the expression pattern of lncRNA THRIL in COVID-19&#46; Similar to the expression level of MALAT-1&#44; THRIL was significantly overexpressed in acute COVID-19 group compared to healthy samples&#46; Comparison between acute and post-acute COVID-19 groups&#44; the mean expression level of THRIL was significantly down-regulated during acute to post-acute phase&#46; As well&#44; the AUC value shows that PBMC THRIL can serve as a biomarker in the discrimination of COVID-19 patients from healthy subjects and those in the acute phase of COVID-19 from those in the post-acute phase of COVID-19 disease&#46;</p><p id="para0029" class="elsevierStylePara elsevierViewall">MiR-155-5p has been known as the &#8216;master of inflammation&#8217; during COVID-19 disease and constitutes part of an immunopathological picture in COVID-19 disease&#46; In inflammatory responses&#44; miR-155-5p controls NF-&#954;B signaling and plays a critical role in the modulating the immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0049"><span class="elsevierStyleSup">49</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0064"><span class="elsevierStyleSup">64</span></a> The miR-155-5p expression is considered to be the initial step in the NF&#8208;&#954;B signaling upregulation of the immune cascade and feeding back through the IKK signalosome complex and PI3K&#47;Akt to further increase NF&#8208;&#954;B&#46; It has been reported that regulation of miR-155-5p levels by glucocorticoids&#44; can be considered as one of the effective COVID-19 treatments&#46;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">65</span></a> Although the expression level of miR-155-5p was upregulated in COVID-19 patients&#44; there is no literature so far investigating miRNA-155 mechanism in COVID-19&#46;<a class="elsevierStyleCrossRef" href="#bib0048"><span class="elsevierStyleSup">48</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0052"><span class="elsevierStyleSup">52</span></a><span class="elsevierStyleSup">&#44;</span><a class="elsevierStyleCrossRef" href="#bib0066"><span class="elsevierStyleSup">66</span></a> However&#44; preceding reports has demonstrated that miRNA-155 has a strong impact in NF-&#954;B signaling&#46;<a class="elsevierStyleCrossRef" href="#bib0064"><span class="elsevierStyleSup">64</span></a> Our results are in line with previous studies in which the mean expression level of miR-150-5p in acute-COVID-19 subjects are significantly higher than in the healthy subjects and in post-acute COVID-19 group&#46; In addition&#44; according to ROC curve results for miR-150-5p&#44; this miRNA may be considered a novel biomarker for acute COVID-19 disease diagnosis&#46;</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0021">Conclusion</span><p id="para0030" class="elsevierStylePara elsevierViewall">According to the findings of the present study&#44; expression pattern of inflammation-related ncRNAs including MALAT-1&#44; NEAT-1&#44; and miR-150-5p were significantly different between COVID-19 patients and healthy subjects&#46; In addition&#44; the level of miR-150-5p&#44; MALAT-1&#44; and NEAT-1 were significantly downregulated from the acute phase of COVID-19 to the post-acute phase of COVID-19&#46; Aberrant expression of ncRNAs was found in COVID-19 disease&#44; which maybe associated with the pathogenesis of SARS-CoV-2 and identification of these factors can be helpful in setting a basis for classification of disease conditions and acting as biomarkers and even be considered as a valuable therapeutic target for the treatment of COVID-19 diseases&#46; Finally&#44; the low number of samples in this study was the main limitation of our work&#46; Hence&#44; the assessment of these non-coding RNAs in a large population is needed&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:9 [
        0 => array:3 [
          "identificador" => "xres1738159"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abss0001"
              "titulo" => "Introduction"
            ]
            1 => array:2 [
              "identificador" => "abss0002"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abss0003"
              "titulo" => "Result"
            ]
            3 => array:2 [
              "identificador" => "abss0004"
              "titulo" => "Discussion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1533270"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0001"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0002"
          "titulo" => "Patients and methods"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0003"
              "titulo" => "Patients&#8217; selection"
            ]
            1 => array:2 [
              "identificador" => "sec0004"
              "titulo" => "Ethical issues"
            ]
            2 => array:2 [
              "identificador" => "sec0005"
              "titulo" => "Preparation of peripheral blood mononuclear cells &#40;PBMCs&#41;"
            ]
            3 => array:2 [
              "identificador" => "sec0006"
              "titulo" => "Total RNA isolation and complementary DNA &#40;cDNA&#41; synthesis"
            ]
            4 => array:2 [
              "identificador" => "sec0007"
              "titulo" => "Expression analysis of genes using real-time PCR"
            ]
            5 => array:2 [
              "identificador" => "sec0008"
              "titulo" => "miRNA-155-5p expression analysis"
            ]
            6 => array:2 [
              "identificador" => "sec0009"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0011"
              "titulo" => "Characteristics of participants"
            ]
            1 => array:2 [
              "identificador" => "sec0012"
              "titulo" => "Expression pattern of ncRNAs was significantly deregulated during COVID-19 disease"
            ]
            2 => array:2 [
              "identificador" => "sec0013"
              "titulo" => "The correlation between clinical characteristics and relative expressions of ncRNAs"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0014"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0015"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "xack613809"
          "titulo" => "Acknowledgments"
        ]
        8 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-01-15"
    "fechaAceptado" => "2022-04-11"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1533270"
          "palabras" => array:5 [
            0 => "COVID-19"
            1 => "Long non-coding RNAs"
            2 => "MicroRNAs"
            3 => "Inflammation"
            4 => "Biomarker"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abss0001" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0002">Introduction</span><p id="spara008" class="elsevierStyleSimplePara elsevierViewall">One of the hallmarks of COVID-19 is overwhelming inflammation&#44; which plays a very important role in the pathogenesis of COVID-19&#46; Thus&#44; identification of inflammatory factors that interact with the SARS-CoV-2 can be very important to control and diagnose the severity of COVID-19&#46; The aim of this study was to investigate the expression patterns of inflammation-related non-coding RNAs &#40;ncRNAs&#41; including MALAT-1&#44; NEAT-1&#44; THRIL&#44; and miR-155-5p from the acute phase to the recovery phase of COVID-19&#46;</p></span> <span id="abss0002" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0003">Methods</span><p id="spara009" class="elsevierStyleSimplePara elsevierViewall">Total RNA was extracted from Peripheral Blood Mononuclear Cell &#40;PBMC&#41; samples of 20 patients with acute COVID-19 infection and 20 healthy individuals and the expression levels of MALAT-1&#44; NEAT-1&#44; THRIL&#44; and miR-155-5p were evaluated by real-time PCR assay&#46; Besides&#44; in order to monitor the expression pattern of selected ncRNAs from the acute phase to the recovery phase of COVID-19 disease&#44; the levels of ncRNAs were re-measured 6&#8210;7 weeks after the acute phase&#46;</p></span> <span id="abss0003" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0004">Result</span><p id="spara010" class="elsevierStyleSimplePara elsevierViewall">The mean expression levels of MALAT-1&#44; THRIL&#44; and miR-155-5p were significantly increased in the acute phase of COVID-19 compared with a healthy control group&#46; In addition&#44; the expression levels of MALAT-1 and THRIL in the post-acute phase of COVID-19 were significantly lower than in the acute phase of COVID-19&#46; According to the ROC curve analysis&#44; these ncRNAs could be considered useful biomarkers for COVID-19 diagnosis and for discriminating between acute and post-acute phase of COVID-19&#46;</p></span> <span id="abss0004" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="cesectitle0005">Discussion</span><p id="spara011" class="elsevierStyleSimplePara elsevierViewall">Inflammation-related ncRNAs &#40;MALAT-1&#44; THRIL&#44; and miR-150-5p&#41; can act as hopeful biomarkers for the monitoring and diagnosis of COVID-19 disease&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abss0001"
            "titulo" => "Introduction"
          ]
          1 => array:2 [
            "identificador" => "abss0002"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abss0003"
            "titulo" => "Result"
          ]
          3 => array:2 [
            "identificador" => "abss0004"
            "titulo" => "Discussion"
          ]
        ]
      ]
    ]
    "multimedia" => array:6 [
      0 => array:8 [
        "identificador" => "fig0001"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1640
            "Ancho" => 1542
            "Tamanyo" => 129838
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0004"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara001" class="elsevierStyleSimplePara elsevierViewall">Comparison of expression level of ncRNAs between &#40;A&#41; Acute and post-acute COVID-19 groups with healthy controls and between &#40;B&#41; acute COVID-19 groups with post-acute COVID-19 groups &#40;ns&#44; not significant&#44; &#42; p &#60; 0&#46;05&#59; &#42;&#42;&#42; p &#60; 0&#46;001&#59; &#42;&#42;&#42;&#42; p &#60; 0&#46;0001&#41;&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0002"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2297
            "Ancho" => 1542
            "Tamanyo" => 227019
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0005"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara002" class="elsevierStyleSimplePara elsevierViewall">ROC analysis for evaluating the diagnostic ability of ncRNAs to discriminate SARS-CoV-2 infected group from uninfected groups &#40;AUC&#44; Area Under the Curve&#59; P&#44; p-value&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0003"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2033
            "Ancho" => 2417
            "Tamanyo" => 205134
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0006"
            "detalle" => "Fig&#46; "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara003" class="elsevierStyleSimplePara elsevierViewall">Spearman&#39;s correlation coefficient between the expression level of lncRNAs &#40;MALAT-1&#44; NEAT-1 and THRIL&#41; with expression level of miR-155-5p&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0001"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0001"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spara005" class="elsevierStyleSimplePara elsevierViewall">MALAT-1&#44; Metastasis Associated Lung Adenocarcinoma Transcript 1&#59; NEAT-1&#44; Nuclear Paraspeckle Assembly Transcript 1&#59; THRIL&#44; TNF and HNRNPL Related Immunoregulatory Long non-coding RNA&#59; GAPDH&#44; Glyceraldehyde 3-Phosphate Dehydrogenase&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0001"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Size&#47;bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0002"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Sequences&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0003"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Name&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0004"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Direction&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0005"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Real-time PCR based on SYBR-Green I fluorescence&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0006"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">76&#47;bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0007"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- CTTCCCTAGGGGATTTCAGG -3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0008"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">MALAT-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0009"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0010"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Real Time PCR for MALAT-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0011"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0012"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- GCCCACAGGAACAAGTCCTA -3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0013"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">MALAT-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0014"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0015"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0016"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">116&#47;bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0017"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- CTTCCTCCCTTTAACTTATCCATTCAC -3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0018"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">NEAT-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0019"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0020"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Real Time PCR for NEAT-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0021"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0022"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- CTCTTCCTCCACCATTACCAACAATAC-3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0023"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">NEAT-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0024"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0025"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0026"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">121&#47;bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0027"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- GAGTGCAGTGGCGTGATCTC -3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0028"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">THRIL-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0029"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0030"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Real Time PCR for THRIL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0031"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0032"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- AAAATTAGTCAGGCATGGTGGTG -3&#8242;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0033"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">THRIL-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0034"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0035"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0036"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">163&#47;bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0037"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;-CGACCACTTTGTCAAGCTCA-3&#697;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0038"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GAPDH-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0039"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0040"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Real Time PCR for GAPDH&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0041"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0042"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;-CCCTGTTGCTGTAGCCAAAT-3&#697;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0043"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">GAPDH-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0044"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0045"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0046"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">73&#47;bp&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0047"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- GTGGCCGAGGACTTTGATTG-3&#697;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0048"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#946;-actin-F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0049"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0050"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Real Time PCR for &#946;-actin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0051"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0052"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">5&#8242;- CCTGTAACAACGCATCTCATATT-3&#697;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0053"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#946;-actin-R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0054"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0055"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara004" class="elsevierStyleSimplePara elsevierViewall">Primers used in this study for determining of expression profile of long non-coding RNAs &#40;lncRNAs&#41;&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0002"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0002"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0056"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Parameters&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0057"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0058"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0059"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0060"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">p-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0061"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="5" align="left" valign="top">Healthy individuals</td></tr><tr title="table-row"><a name="en0062"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0063"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0064"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0065"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">50 &#40;100&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0066"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0067"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Age&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0068"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">37&#46;2&#177;13&#46;3 &#40;23&#8210;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0069"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">35&#46;0&#177;11&#46;2 &#40;24&#8210;59&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0070"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">36&#46;2&#177;12&#46;1 &#40;23&#8210;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0071"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;569 Student <span class="elsevierStyleItalic">t</span> test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0072"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="5" align="left" valign="top">SARS-CoV-2 infected participants</td></tr><tr title="table-row"><a name="en0073"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0074"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0075"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0076"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">50 &#40;100&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0077"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">&#8210;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0078"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Age&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0079"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">38&#46;1&#177;8&#46;6 &#40;28&#8210;53&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0080"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">34&#46;0&#177;12&#46;9 &#40;22&#8210;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0081"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">36&#46;1&#177;10&#46;9 &#40;22&#8210;67&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0082"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;415 Student <span class="elsevierStyleItalic">t</span> test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0083"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="5" align="left" valign="top">Clinical manifestations of patients with SARS-CoV-2 infection</td></tr><tr title="table-row"><a name="en0084"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Fever&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0085"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;70&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0086"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30 &#40;60&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0087"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">65 &#40;65&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0088"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0089"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Chills&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0090"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0091"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;70&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0092"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60 &#40;60&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0093"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;650 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0094"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Headache&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0095"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;70&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0096"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;80&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0097"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">75 &#40;75&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0098"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0099"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Skeletal pain&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0100"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;70&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0101"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;70&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0102"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">70 &#40;70&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0103"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0104"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Chest pain&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0105"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0106"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;30&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0107"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;25&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0108"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0109"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Shortness of breath&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0110"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0111"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0112"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0113"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0114"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Decreased smell&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0115"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;10&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0116"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0117"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30 &#40;30&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0118"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;141 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0119"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Decreased taste&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0120"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0121"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;30&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0122"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;25&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0123"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0124"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Confusion&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0125"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0126"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;10&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0127"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;15&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0128"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0129"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Dry cough&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0130"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;40&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0131"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30 &#40;60&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0132"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">50 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0133"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;658 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0134"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Sputum cough&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0135"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;20&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0136"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;00&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0137"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10 &#40;10&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0138"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">0&#46;474 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0139"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Runny nose&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0140"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;30&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0141"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;40&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0142"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">35 &#40;35&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0143"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0144"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Cape of nose&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0145"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;40&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0146"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0147"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45 &#40;45&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0148"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0149"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Bleeding stomach&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0150"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;00&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0151"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;10&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0152"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;5&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0153"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0154"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">Gastrointestinal symptoms&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0155"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">25 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0156"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;40&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0157"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45 &#40;45&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0158"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="top">1&#46;000 Fisher&#39;s exact test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara006" class="elsevierStyleSimplePara elsevierViewall">The demographic parameters of the studied participants and clinical manifestations of patients with SARS-CoV-2 infection&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0003"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "alt0003"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><a name="en0159"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0160"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">MALAT-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0161"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">NEAT-1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0162"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">THRIL&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><a name="en0163"></a><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">miR-155-5p&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><a name="en0164"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">RdRp</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0165"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;43<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0166"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;28<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0167"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;4<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0168"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;7<a class="elsevierStyleCrossRef" href="#tb3fn3"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0169"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">N gene</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0170"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;35<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0171"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;24<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0172"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;33<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0173"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;61<a class="elsevierStyleCrossRef" href="#tb3fn2"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0174"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Sex Age</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0175"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;09<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0176"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;17<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0177"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;07<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0178"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;05<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0179"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Bleeding stomach</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0180"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;11<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0181"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;28<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0182"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;28<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0183"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;08<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0184"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Gastrointestinal symptoms</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0185"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;37<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0186"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;02<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0187"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;16<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0188"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;08<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0189"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Decreased taste</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0190"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;33<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0191"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;45<a class="elsevierStyleCrossRef" href="#tb3fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0192"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;04<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0193"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;02<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0194"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Decreased smell</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0195"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;05<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0196"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;07<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0197"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;14<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0198"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;18<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0199"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Cape of nose</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0200"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;12<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0201"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;3<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0202"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;41<a class="elsevierStyleCrossRef" href="#tb3fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0203"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;07<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0204"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Runny nose</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0205"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;1<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0206"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;24<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0207"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;36<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0208"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;19<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0209"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Shortness of breath</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0210"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;1<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0211"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;38<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0212"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;38<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0213"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;36<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0214"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Chest pain</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0215"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;07<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0216"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;43<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0217"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;46<a class="elsevierStyleCrossRef" href="#tb3fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0218"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;3<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0219"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Sputum cough</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0220"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;31<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0221"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;58<a class="elsevierStyleCrossRef" href="#tb3fn2"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0222"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;42<a class="elsevierStyleCrossRef" href="#tb3fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0223"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;41<a class="elsevierStyleCrossRef" href="#tb3fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0224"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Dry cough</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0225"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;2<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0226"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;46<a class="elsevierStyleCrossRef" href="#tb3fn1"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0227"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;57<a class="elsevierStyleCrossRef" href="#tb3fn2"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0228"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;31<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0229"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Skeletal pain</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0230"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;55<a class="elsevierStyleCrossRef" href="#tb3fn2"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0231"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;13<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0232"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;2<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0233"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;001<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0234"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Chills</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0235"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;28<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0236"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;17<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0237"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;39<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0238"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;13<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0239"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Headache</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0240"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;18<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0241"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;2<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0242"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;13<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0243"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;33<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0244"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Confusion</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0245"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;07<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0246"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;36<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0247"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;17<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0248"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;13<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><a name="en0249"></a><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="" valign="top"><span class="elsevierStyleBold">Fever</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0250"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;61<a class="elsevierStyleCrossRef" href="#tb3fn3"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0251"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;1<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0252"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;004<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><a name="en0253"></a><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;2<span class="elsevierStyleSup">ns</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
          "notaPie" => array:3 [
            0 => array:3 [
              "identificador" => "tb3fn1"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="notep0002">p &#60; 0&#46;05</p>"
            ]
            1 => array:3 [
              "identificador" => "tb3fn2"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="notep0003">p &#60; 0&#46;01</p>"
            ]
            2 => array:3 [
              "identificador" => "tb3fn3"
              "etiqueta" => "c"
              "nota" => "<p class="elsevierStyleNotepara" id="notep0004">p &#60; 0&#46;001&#59; ns&#44; not significant&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spara007" class="elsevierStyleSimplePara elsevierViewall">Spearman&#39;s correlation coefficient between the expression level of ncRNAs with expression level of SARS-CoV-2 genes &#40;N and RdRp genes&#41;&#44; demographic and clinical characteristics&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "cebibsec1"
          "bibliografiaReferencia" => array:66 [
            0 => array:3 [
              "identificador" => "bib0001"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Striking absence of &#34;usual suspects&#34; during the winter of the Coronavirus Disease 2019 &#40;COVID-19&#41; pandemic 2020-2021"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "SS Sarvepalli"
                            1 => "ABV Cruz"
                            2 => "T Chopra"
                            3 => "H Salimnia"
                            4 => "P&#46; Chandrasekar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Infect Control Hospital Epidemiol"
                        "fecha" => "2021"
                        "paginaInicial" => "1"
                        "paginaFinal" => "2"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0002"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Origin and evolution of pathogenic coronaviruses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J Cui"
                            1 => "F Li"
                            2 => "ZL&#46; Shi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41579-018-0118-9"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Rev Microbiol"
                        "fecha" => "2019"
                        "volumen" => "17"
                        "paginaInicial" => "181"
                        "paginaFinal" => "192"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30531947"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X13012401"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0003"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mechanisms of lncRNA&#47;microRNA interactions in angiogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Z Zhao"
                            1 => "W Sun"
                            2 => "Z Guo"
                            3 => "J Zhang"
                            4 => "H Yu"
                            5 => "B Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Life Sci"
                        "fecha" => "2020"
                        "volumen" => "254"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0004"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Roles of LncRNAs in viral infections"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "W Liu"
                            1 => "C&#46; Ding"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fcimb.2017.00205"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Cell Infect Microbiol"
                        "fecha" => "2017"
                        "volumen" => "7"
                        "paginaInicial" => "205"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28603696"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human microRNA hsa-miR-125a-5p interferes with expression of hepatitis B virus surface antigen"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "N Potenza"
                            1 => "U Papa"
                            2 => "N Mosca"
                            3 => "F Zerbini"
                            4 => "V Nobile"
                            5 => "A&#46; Russo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/nar/gkr067"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nucl Acids Res"
                        "fecha" => "2011"
                        "volumen" => "39"
                        "paginaInicial" => "5157"
                        "paginaFinal" => "5163"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21317190"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0006"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA&#44; miRNA and lncRNA-miRNA interaction in viral infection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "L Chen"
                            1 => "Y Zhou"
                            2 => "H&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.virusres.2018.08.018"
                      "Revista" => array:7 [
                        "tituloSerie" => "Virus Res"
                        "fecha" => "2018"
                        "volumen" => "257"
                        "paginaInicial" => "25"
                        "paginaFinal" => "32"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30165080"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X19305390"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0007"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The assessment of selected MiRNAs profile in HIV&#44; HBV&#44; HCV&#44; HIV&#47;HCV&#44; HIV&#47;HBV Co-infection and elite controllers for determination of biomarker"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Yousefpouran"
                            1 => "S Mostafaei"
                            2 => "PV Manesh"
                            3 => "E Iranifar"
                            4 => "F Bokharaei-Salim"
                            5 => "JS Nahand"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Microb Pathog"
                        "fecha" => "2020"
                        "volumen" => "147"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0008"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-155&#58; an ancient regulator of the immune system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "E Vigorito"
                            1 => "S Kohlhaas"
                            2 => "D Lu"
                            3 => "R&#46; Leyland"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/imr.12057"
                      "Revista" => array:6 [
                        "tituloSerie" => "Immunol Rev"
                        "fecha" => "2013"
                        "volumen" => "253"
                        "paginaInicial" => "146"
                        "paginaFinal" => "157"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23550644"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0009"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-155 is induced during the macrophage inflammatory response"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "RM O&#39;Connell"
                            1 => "KD Taganov"
                            2 => "MP Boldin"
                            3 => "G Cheng"
                            4 => "D&#46; Baltimore"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.0610731104"
                      "Revista" => array:7 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2007"
                        "volumen" => "104"
                        "numero" => "5"
                        "paginaInicial" => "1604"
                        "paginaFinal" => "1609"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17242365"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-155 controls t helper cell activation during viral infection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E Goncalves-Alves"
                            1 => "V Saferding"
                            2 => "C Schliehe"
                            3 => "R Benson"
                            4 => "M Kurowska-Stolarska"
                            5 => "JS Brunner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fimmu.2019.01367"
                      "Revista" => array:6 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "1367"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31275315"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1473309920305922"
                          "estado" => "S300"
                          "issn" => "14733099"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0011"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA expression profile of mouse lung infected with 2009 pandemic H1N1 influenza virus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z Wu"
                            1 => "R Hao"
                            2 => "P Li"
                            3 => "X Zhang"
                            4 => "N Liu"
                            5 => "S Qiu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0074190"
                      "Revista" => array:6 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2013"
                        "volumen" => "8"
                        "paginaInicial" => "e74190"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24066118"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X19300039"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0012"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased expression of microRNA-155-5p by alveolar type II cells contributes to development of lethal ARDS in H1N1 influenza A virus-infected mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "PS Woods"
                            1 => "LM Doolittle"
                            2 => "LE Rosas"
                            3 => "SP Nana-Sinkam"
                            4 => "E Tili"
                            5 => "IC&#46; Davis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.virol.2020.03.005"
                      "Revista" => array:7 [
                        "tituloSerie" => "Virology"
                        "fecha" => "2020"
                        "volumen" => "545"
                        "paginaInicial" => "40"
                        "paginaFinal" => "52"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32308197"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S2213260018304193"
                          "estado" => "S300"
                          "issn" => "22132600"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0013"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-155&#58; a novel armamentarium against inflammatory diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W Xiaoyan"
                            1 => "EMA Pais"
                            2 => "L Lan"
                            3 => "C Jingrui"
                            4 => "M Lin"
                            5 => "PA Fordjour"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10753-016-0488-y"
                      "Revista" => array:6 [
                        "tituloSerie" => "Inflammation"
                        "fecha" => "2017"
                        "volumen" => "40"
                        "paginaInicial" => "708"
                        "paginaFinal" => "716"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27981414"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0014"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-155 and antiviral immune responses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A Jafarzadeh"
                            1 => "A Naseri"
                            2 => "L Shojaie"
                            3 => "M Nemati"
                            4 => "S Jafarzadeh"
                            5 => "HB Baghi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.intimp.2021.108269"
                      "Revista" => array:4 [
                        "tituloSerie" => "Int Immunopharmacol"
                        "fecha" => "2021"
                        "volumen" => "101"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34688137"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nuclear factor-kappa B and its role in inflammatory lung disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "KS Alharbi"
                            1 => "NK Fuloria"
                            2 => "S Fuloria"
                            3 => "SB Rahman"
                            4 => "WH Al-Malki"
                            5 => "MAJ Shaikh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:2 [
                        "tituloSerie" => "Chemico-Biolog Interact"
                        "fecha" => "2021"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0016"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Noncoding RNAs&#58; master regulators of inflammatory signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "CL Chew"
                            1 => "SA Conos"
                            2 => "B Unal"
                            3 => "V&#46; Tergaonkar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Trends Molec Med"
                        "fecha" => "2018"
                        "volumen" => "24"
                        "paginaInicial" => "66"
                        "paginaFinal" => "84"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0017"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inhibition of long noncoding RNA MALAT1 suppresses high glucose-induced apoptosis and inflammation in human umbilical vein endothelial cells by suppressing the NF-&#954;B signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y-P Gong"
                            1 => "Y-W Zhang"
                            2 => "X-Q Su"
                            3 => "H-B&#46; Gao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1139/bcb-2019-0403"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Cell Biol"
                        "fecha" => "2020"
                        "volumen" => "98"
                        "paginaInicial" => "669"
                        "paginaFinal" => "675"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32502356"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0018"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long noncoding RNA MALAT1 contributes to inflammatory response of microglia following spinal cord injury via the modulation of a miR-199b&#47;IKK&#946;&#47;NF-&#954;B signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H-J Zhou"
                            1 => "L-Q Wang"
                            2 => "D-B Wang"
                            3 => "J-B Yu"
                            4 => "Y Zhu"
                            5 => "Q-S Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajpcell.00278.2017"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Physiol-Cell Physiol"
                        "fecha" => "2018"
                        "volumen" => "315"
                        "paginaInicial" => "C52"
                        "paginaFinal" => "C61"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29631367"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X21003170"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0019"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long non-coding RNA NEAT1 plays an important role in sepsis-induced acute kidney injury by targeting miR-204 and modulating the NF-&#954;B pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y Chen"
                            1 => "J Qiu"
                            2 => "B Chen"
                            3 => "Y Lin"
                            4 => "Y Chen"
                            5 => "G Xie"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Inter Immunopharmacol"
                        "fecha" => "2018"
                        "volumen" => "59"
                        "paginaInicial" => "252"
                        "paginaFinal" => "260"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The lncRNA Neat1 promotes activation of inflammasomes in macrophages"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P Zhang"
                            1 => "L Cao"
                            2 => "R Zhou"
                            3 => "X Yang"
                            4 => "M&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41467-019-09482-6"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Commun"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "1495"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30940803"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0021"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "LV Borovikova"
                            1 => "S Ivanova"
                            2 => "M Zhang"
                            3 => "H Yang"
                            4 => "GI Botchkina"
                            5 => "LR Watkins"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/35013070"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature"
                        "fecha" => "2000"
                        "volumen" => "405"
                        "paginaInicial" => "458"
                        "paginaFinal" => "462"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10839541"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0022"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Fear and C-reactive protein cosynergize annual pulse increases in healthy adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Shenhar-Tsarfaty"
                            1 => "N Yayon"
                            2 => "N Waiskopf"
                            3 => "I Shapira"
                            4 => "S Toker"
                            5 => "D Zaltser"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.1418264112"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2015"
                        "volumen" => "112"
                        "paginaInicial" => "E467"
                        "paginaFinal" => "E471"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25535364"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0023"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The neat dance of COVID-19&#58; NEAT1&#44; DANCR&#44; and Co-modulated cholinergic RNAs link to inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C Meydan"
                            1 => "N Madrer"
                            2 => "H&#46; Soreq"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Front Immunol"
                        "fecha" => "2020"
                        "volumen" => "11"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0024"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Upregulated lncRNA THRIL&#47;TNF-&#945; signals promote cell growth and predict poor clinical outcomes of osteosarcoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B Xu"
                            1 => "X Jin"
                            2 => "T Yang"
                            3 => "Y Zhang"
                            4 => "S Liu"
                            5 => "L Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/OTT.S235798"
                      "Revista" => array:6 [
                        "tituloSerie" => "OncoTargets Therapy"
                        "fecha" => "2020"
                        "volumen" => "13"
                        "paginaInicial" => "119"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32021260"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X20314687"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The long noncoding RNA THRIL regulates TNF&#945; expression through its interaction with hnRNPL"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z Li"
                            1 => "T-C Chao"
                            2 => "K-Y Chang"
                            3 => "N Lin"
                            4 => "VS Patil"
                            5 => "C Shimizu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.1313768111"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Nat Acad Sci"
                        "fecha" => "2014"
                        "volumen" => "111"
                        "paginaInicial" => "1002"
                        "paginaFinal" => "1007"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24371310"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0026"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long non-coding RNA THRIL inhibits miRNA-24-3p to upregulate neuropilin-1 to aggravate cerebral ischemia-reperfusion injury through regulating the nuclear factor &#954;B p65 signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "F Kuai"
                            1 => "L Zhou"
                            2 => "J Zhou"
                            3 => "X Sun"
                            4 => "W&#46; Dong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Aging &#40;Albany NY&#41;"
                        "fecha" => "2021"
                        "volumen" => "13"
                        "paginaInicial" => "9071"
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X21005028"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0027"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA 155 and viral-induced neuroinflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "LL Dickey"
                            1 => "TM Hanley"
                            2 => "TB Huffaker"
                            3 => "AG Ramstead"
                            4 => "RM O&#39;Connell"
                            5 => "TE&#46; Lane"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jneuroim.2017.01.016"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Neuroimmunol"
                        "fecha" => "2017"
                        "volumen" => "308"
                        "paginaInicial" => "17"
                        "paginaFinal" => "24"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28139244"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0028"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mutator activity induced by microRNA-155 &#40;miR-155&#41; links inflammation and cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E Tili"
                            1 => "JJ Michaille"
                            2 => "D Wernicke"
                            3 => "H Alder"
                            4 => "S Costinean"
                            5 => "S Volinia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.1101795108"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2011"
                        "volumen" => "108"
                        "paginaInicial" => "4908"
                        "paginaFinal" => "4913"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21383199"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0029"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Elevated miR-155 promotes inflammation in cystic fibrosis by driving hyperexpression of interleukin-8"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Bhattacharyya"
                            1 => "NS Balakathiresan"
                            2 => "C Dalgard"
                            3 => "U Gutti"
                            4 => "D Armistead"
                            5 => "C Jozwik"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1074/jbc.M110.198390"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biol Chem"
                        "fecha" => "2011"
                        "volumen" => "286"
                        "paginaInicial" => "11604"
                        "paginaFinal" => "11615"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21282106"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The pro-inflammatory microRNA miR-155 influences fibrillar &#946;-Amyloid&#40;1&#41; &#40;-42&#41; catabolism by microglia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "MS Aloi"
                            1 => "KE Prater"
                            2 => "B Sopher"
                            3 => "S Davidson"
                            4 => "S Jayadev"
                            5 => "GA&#46; Garden"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/glia.23988"
                      "Revista" => array:6 [
                        "tituloSerie" => "Glia"
                        "fecha" => "2021"
                        "volumen" => "69"
                        "paginaInicial" => "1736"
                        "paginaFinal" => "1748"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33694209"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0031"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Metformin regulates inflammation and fibrosis in diabetic kidney disease through TNC&#47;TLR4&#47;NF-&#954;B&#47;miR-155-5p inflammatory loop"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y Zhou"
                            1 => "XY Ma"
                            2 => "JY Han"
                            3 => "M Yang"
                            4 => "C Lv"
                            5 => "Y Shao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4239/wjd.v12.i1.19"
                      "Revista" => array:6 [
                        "tituloSerie" => "World J Diabetes"
                        "fecha" => "2021"
                        "volumen" => "12"
                        "paginaInicial" => "19"
                        "paginaFinal" => "46"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33520106"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0032"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long non-coding RNA MALAT1 regulates hyperglycaemia induced inflammatory process in the endothelial cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P Puthanveetil"
                            1 => "S Chen"
                            2 => "B Feng"
                            3 => "A Gautam"
                            4 => "S&#46; Chakrabarti"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jcmm.12576"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Cell Mol Med"
                        "fecha" => "2015"
                        "volumen" => "19"
                        "paginaInicial" => "1418"
                        "paginaFinal" => "1425"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25787249"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0033"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The long noncoding RNA MALAT1 regulates the lipopolysaccharide-induced inflammatory response through its interaction with NF-&#954;B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G Zhao"
                            1 => "Z Su"
                            2 => "D Song"
                            3 => "Y Mao"
                            4 => "X&#46; Mao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/1873-3468.12315"
                      "Revista" => array:6 [
                        "tituloSerie" => "FEBS Lett"
                        "fecha" => "2016"
                        "volumen" => "590"
                        "paginaInicial" => "2884"
                        "paginaFinal" => "2895"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27434861"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0034"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long noncoding RNA MALAT-1 is a novel inflammatory regulator in human systemic lupus erythematosus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H Yang"
                            1 => "N Liang"
                            2 => "M Wang"
                            3 => "Y Fei"
                            4 => "J Sun"
                            5 => "Z Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/oncotarget.20490"
                      "Revista" => array:7 [
                        "tituloSerie" => "Oncotarget"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "paginaInicial" => "77400"
                        "paginaFinal" => "77406"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29100395"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X19305110"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MALAT1&#58; an epigenetic regulator of inflammation in diabetic retinopathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Biswas"
                            1 => "AA Thomas"
                            2 => "S Chen"
                            3 => "E Aref-Eshghi"
                            4 => "B Feng"
                            5 => "J Gonder"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41598-018-24907-w"
                      "Revista" => array:5 [
                        "tituloSerie" => "Sci Rep"
                        "fecha" => "2018"
                        "volumen" => "8"
                        "paginaInicial" => "6526"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29695738"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0036"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA NEAT1 alleviates sepsis-induced myocardial injury by regulating the TLR2&#47;NF-&#954;B signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "SM Wang"
                            1 => "GQ Liu"
                            2 => "HB Xian"
                            3 => "JL Si"
                            4 => "SX Qi"
                            5 => "YP&#46; Yu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.26355/eurrev_201906_18078"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur Rev Med Pharmacol Sci"
                        "fecha" => "2019"
                        "volumen" => "23"
                        "paginaInicial" => "4898"
                        "paginaFinal" => "4907"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31210324"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0037"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "lncRNA NEAT1 ameliorates LPS&#8209;induced inflammation in MG63 cells by activating autophagy and suppressing the NLRP3 inflammasome"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "W Dai"
                            1 => "M Wang"
                            2 => "P Wang"
                            3 => "J Wen"
                            4 => "J Wang"
                            5 => "S Cha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3892/ijmm.2020.4827"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Med"
                        "fecha" => "2021"
                        "volumen" => "47"
                        "paginaInicial" => "607"
                        "paginaFinal" => "620"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33416115"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0038"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The long noncoding RNA THRIL regulates TNF&#945; expression through its interaction with hnRNPL"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z Li"
                            1 => "TC Chao"
                            2 => "KY Chang"
                            3 => "N Lin"
                            4 => "VS Patil"
                            5 => "C Shimizu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.1313768111"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci USA"
                        "fecha" => "2014"
                        "volumen" => "111"
                        "paginaInicial" => "1002"
                        "paginaFinal" => "1007"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24371310"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0039"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Upregulated lncRNA THRIL&#47;TNF-&#945; signals promote cell growth and predict poor clinical outcomes of osteosarcoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B Xu"
                            1 => "X Jin"
                            2 => "T Yang"
                            3 => "Y Zhang"
                            4 => "S Liu"
                            5 => "L Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/OTT.S235798"
                      "Revista" => array:7 [
                        "tituloSerie" => "Onco Targets Ther"
                        "fecha" => "2020"
                        "volumen" => "13"
                        "paginaInicial" => "119"
                        "paginaFinal" => "129"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32021260"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X19303883"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Zhang K&#44; Mao T&#44; He Z&#44; Wu X&#44; Peng Y&#44; Chen Y&#44; et&#160;al&#46; Serum MALAT1 assumes signifying capacity in gastric cancer diagnosis&#46; 2020&#46;"
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0041"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Diagnostic and prognostic potential of tissue and circulating long non-coding RNAs in colorectal tumors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "O Galamb"
                            1 => "BK Bart&#225;k"
                            2 => "A Kalm&#225;r"
                            3 => "ZB Nagy"
                            4 => "KA Szigeti"
                            5 => "Z Tulassay"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3748/wjg.v25.i34.5026"
                      "Revista" => array:5 [
                        "tituloSerie" => "World J Gastroenterol"
                        "fecha" => "2019"
                        "volumen" => "25"
                        "paginaInicial" => "5026"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31558855"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0042"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Up-regulation of long non-coding RNA THRIL in coronary heart disease&#58; prediction for disease risk&#44; correlation with inflammation&#44; coronary artery stenosis&#44; and major adverse cardiovascular events"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "H Qi"
                            1 => "J Shen"
                            2 => "W&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcla.23196"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Lab Anal"
                        "fecha" => "2020"
                        "volumen" => "34"
                        "paginaInicial" => "e23196"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31944373"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0043"
              "etiqueta" => "43"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Exploring the association of long noncoding RNA expression profiles with intracranial aneurysms&#44; based on sequencing and related bioinformatics analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y Sun"
                            1 => "Y Wen"
                            2 => "Q Ruan"
                            3 => "L Yang"
                            4 => "S Huang"
                            5 => "X Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12920-020-00805-x"
                      "Revista" => array:5 [
                        "tituloSerie" => "BMC Med Genomics"
                        "fecha" => "2020"
                        "volumen" => "13"
                        "paginaInicial" => "147"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33023605"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            43 => array:3 [
              "identificador" => "bib0044"
              "etiqueta" => "44"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of HCV and&#47;or HBV coinfection in Iranian HIV-infected patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F Dehghani-Dehej"
                            1 => "Z Hosseini"
                            2 => "P Mortazkar"
                            3 => "K Khanaliha"
                            4 => "M Esghaei"
                            5 => "A Fakhim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Future Virol"
                        "fecha" => "2020"
                        "volumen" => "15"
                        "paginaInicial" => "155"
                        "paginaFinal" => "163"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            44 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "45"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Reciprocal expression of Slug and Snail in human oral cancer cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R Nakamura"
                            1 => "H Ishii"
                            2 => "K Endo"
                            3 => "A Hotta"
                            4 => "E Fujii"
                            5 => "K Miyazawa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0208783"
                      "Revista" => array:4 [
                        "tituloSerie" => "PLoS One"
                        "fecha" => "2018"
                        "volumen" => "13"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30586373"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            45 => array:3 [
              "identificador" => "bib0046"
              "etiqueta" => "46"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acute and post-acute phase of COVID-19&#58; analyzing expression patterns of miRNA-29a-3p&#44; 146a-3p&#44; 155-5p&#44; and let-7b-3p in PBMC"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T Donyavi"
                            1 => "F Bokharaei-Salim"
                            2 => "HB Baghi"
                            3 => "K Khanaliha"
                            4 => "M Alaei Janat-Makan"
                            5 => "B Karimi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Inter Immunopharmacol"
                        "fecha" => "2021"
                        "volumen" => "97"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            46 => array:3 [
              "identificador" => "bib0047"
              "etiqueta" => "47"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of relative gene expression data using real-time quantitative PCR and the 2&#8722; &#916;&#916;CT method"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "KJ Livak"
                            1 => "TD&#46; Schmittgen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1006/meth.2001.1262"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods"
                        "fecha" => "2001"
                        "volumen" => "25"
                        "paginaInicial" => "402"
                        "paginaFinal" => "408"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11846609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            47 => array:3 [
              "identificador" => "bib0048"
              "etiqueta" => "48"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Soni DK&#44; Cabrera-Luque J&#44; Kar S&#44; Sen C&#44; Devaney J&#44; Biswas R&#46; Suppression of miR-155 attenuates lung cytokine storm induced by SARS-CoV-2 infection in human ACE2-transgenic mice&#46; bioRxiv&#46; 2020&#46;"
                ]
              ]
            ]
            48 => array:3 [
              "identificador" => "bib0049"
              "etiqueta" => "49"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-155&#58; a master regulator of inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "G Mahesh"
                            1 => "R&#46; Biswas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/jir.2018.0155"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Interferon Cytokine Res"
                        "fecha" => "2019"
                        "volumen" => "39"
                        "paginaInicial" => "321"
                        "paginaFinal" => "330"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30998423"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            49 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "50"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Onyeagucha BC&#46; The contribution of inflammatory pathway signaling and microRNA changes to colon cancer progression&#58; the University of Arizona&#59; 2013&#46;"
                ]
              ]
            ]
            50 => array:3 [
              "identificador" => "bib0051"
              "etiqueta" => "51"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Non-coding RNAs&#58; master regulators of inflammasomes in inflammatory diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "W Wang"
                            1 => "N Yang"
                            2 => "Y-H Yang"
                            3 => "R Wen"
                            4 => "C-F Liu"
                            5 => "T-N&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Inflam Res"
                        "fecha" => "2021"
                        "volumen" => "14"
                        "paginaInicial" => "5023"
                        "paginaFinal" => "5050"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            51 => array:3 [
              "identificador" => "bib0052"
              "etiqueta" => "52"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acute and post-acute phase of COVID-19&#58; analyzing expression patterns of miRNA-29a-3p&#44; 146a-3p&#44; 155-5p&#44; and let-7b-3p in PBMC"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T Donyavi"
                            1 => "F Bokharaei-Salim"
                            2 => "HB Baghi"
                            3 => "K Khanaliha"
                            4 => "MA Janat-Makan"
                            5 => "B Karimi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Inter Immunopharmacol"
                        "fecha" => "2021"
                        "volumen" => "97"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            52 => array:3 [
              "identificador" => "bib0053"
              "etiqueta" => "53"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Non-coding RNAs in COVID-19&#58; emerging insights and current questions"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "T Plowman"
                            1 => "D&#46; Lagos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ncrna7030054"
                      "Revista" => array:5 [
                        "tituloSerie" => "Non-Coding RNA"
                        "fecha" => "2021"
                        "volumen" => "7"
                        "paginaInicial" => "54"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34564316"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            53 => array:3 [
              "identificador" => "bib0054"
              "etiqueta" => "54"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Protein coding and long noncoding RNA &#40;lncRNA&#41; transcriptional landscape in SARS-CoV-2 infected bronchial epithelial cells highlight a role for interferon and inflammatory response"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R Vishnubalaji"
                            1 => "H Shaath"
                            2 => "NM&#46; Alajez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Genes"
                        "fecha" => "2020"
                        "volumen" => "11"
                        "paginaInicial" => "760"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            54 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "55"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Huang K&#44; Wang C&#44; Vagts C&#44; Raguveer V&#44; Finn P&#44; Perkins DL&#46; LncRNAs NEAT1 and MALAT1 differentiate inflammation in severe COVID-19 patients&#46; medRxiv&#46; 2021&#46;"
                ]
              ]
            ]
            55 => array:3 [
              "identificador" => "bib0056"
              "etiqueta" => "56"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Silencing of lncRNA MALAT1 prevents inflammatory injury after lung transplant ischemia-reperfusion by downregulation of IL-8 via p300"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L Wei"
                            1 => "J Li"
                            2 => "Z Han"
                            3 => "Z Chen"
                            4 => "Q&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Therapy-Nucl Acids"
                        "fecha" => "2019"
                        "volumen" => "18"
                        "paginaInicial" => "285"
                        "paginaFinal" => "297"
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X14005969"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            56 => array:3 [
              "identificador" => "bib0057"
              "etiqueta" => "57"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long noncoding RNA Malat1 regulates differential activation of macrophages and response to lung injury"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H Cui"
                            1 => "S Banerjee"
                            2 => "S Guo"
                            3 => "N Xie"
                            4 => "J Ge"
                            5 => "D Jiang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/jci.insight.122686"
                      "Revista" => array:5 [
                        "tituloSerie" => "JCI Insight"
                        "fecha" => "2019"
                        "volumen" => "4"
                        "numero" => "4"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30730308"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            57 => array:3 [
              "identificador" => "bib0058"
              "etiqueta" => "58"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Malat1 suppresses immunity to infection through promoting expression of maf and IL-10 in Th cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "JP Hewitson"
                            1 => "KA West"
                            2 => "KR James"
                            3 => "GF Rani"
                            4 => "N Dey"
                            5 => "A Romano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4049/jimmunol.1900940"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Immunol"
                        "fecha" => "2020"
                        "volumen" => "204"
                        "paginaInicial" => "2949"
                        "paginaFinal" => "2960"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32321759"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            58 => array:3 [
              "identificador" => "bib0059"
              "etiqueta" => "59"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "NEAT1 and MALAT1 are highly expressed in saliva and nasopharyngeal swab sample of COVID-19 patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "AC Rodrigues"
                            1 => "D Adamoski"
                            2 => "G Genelhould"
                            3 => "F Zhen"
                            4 => "GE Yamaguto"
                            5 => "PS de Araujo Souza"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:2 [
                        "tituloSerie" => "Mol Oral Microbiol"
                        "fecha" => "2021"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            59 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "60"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The lncRNA Neat1 promotes activation of inflammasomes in macrophages"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "P Zhang"
                            1 => "L Cao"
                            2 => "R Zhou"
                            3 => "X Yang"
                            4 => "M&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41467-018-07882-8"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nat Commun"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "1"
                        "paginaFinal" => "17"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30602773"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            60 => array:3 [
              "identificador" => "bib0061"
              "etiqueta" => "61"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Huang K&#44; Wang C&#44; Vagts C&#44; Raguveer V&#44; Finn PW&#44; Perkins DL&#46; LncRNAs NEAT1 and MALAT1 differentiate inflammation in severe COVID-19 patients&#46; medRxiv&#46; 2021&#58;2021&#46;03&#46;26&#46;21254445&#46;"
                ]
              ]
            ]
            61 => array:3 [
              "identificador" => "bib0062"
              "etiqueta" => "62"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A long noncoding RNA mediates both activation and repression of immune response genes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S Carpenter"
                            1 => "D Aiello"
                            2 => "MK Atianand"
                            3 => "EP Ricci"
                            4 => "P Gandhi"
                            5 => "LL Hall"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1126/science.1240925"
                      "Revista" => array:7 [
                        "tituloSerie" => "Science"
                        "fecha" => "2013"
                        "volumen" => "341"
                        "paginaInicial" => "789"
                        "paginaFinal" => "792"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23907535"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0264410X17302475"
                          "estado" => "S300"
                          "issn" => "0264410X"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            62 => array:3 [
              "identificador" => "bib0063"
              "etiqueta" => "63"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Necroptosis and inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K Newton"
                            1 => "G&#46; Manning"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1146/annurev-biochem-060815-014830"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Rev Biochem"
                        "fecha" => "2016"
                        "volumen" => "85"
                        "paginaInicial" => "743"
                        "paginaFinal" => "763"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26865533"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            63 => array:3 [
              "identificador" => "bib0064"
              "etiqueta" => "64"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An NF-&#954;B-microRNA regulatory network tunes macrophage inflammatory responses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M Mann"
                            1 => "A Mehta"
                            2 => "JL Zhao"
                            3 => "K Lee"
                            4 => "GK Marinov"
                            5 => "Y Garcia-Flores"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41467-016-0009-6"
                      "Revista" => array:7 [
                        "tituloSerie" => "Nat Commun"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "numero" => "1"
                        "paginaInicial" => "1"
                        "paginaFinal" => "13"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28232747"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            64 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "65"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dexamethasone in hospitalized patients with COVID-19 &#8210; preliminary report"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "TRC&#46; Group"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1915928"
                      "Revista" => array:3 [
                        "tituloSerie" => "New Engl J Med"
                        "fecha" => "2020"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32222134"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            65 => array:3 [
              "identificador" => "bib0066"
              "etiqueta" => "66"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Circulating cardiovascular microRNAs in critically ill COVID-19 patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A Garg"
                            1 => "B Seeliger"
                            2 => "AA Derda"
                            3 => "K Xiao"
                            4 => "A Gietz"
                            5 => "K Scherf"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Euro J Heart Fail"
                        "fecha" => "2021"
                        "volumen" => "23"
                        "paginaInicial" => "468"
                        "paginaFinal" => "475"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack613809"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="para0031" class="elsevierStylePara elsevierViewall">The authors of the current survey would like to thank all of the volunteers who have participated in this research&#46; The present study was funded by Research Deputy of Iran University of Medical Sciences&#44; Tehran&#44; Iran with Grant number 20975&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/14138670/0000002600000003/v1_202206230723/S1413867022000423/v1_202206230723/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "10849"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/14138670/0000002600000003/v1_202206230723/S1413867022000423/v1_202206230723/en/main.pdf?idApp=UINPBA00003Y&text.app=https://bjid.org.br/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867022000423?idApp=UINPBA00003Y"
]
Share