This was a retrospective observational study in which 73 CD-positive male patients were evaluated. These patients received care at the General Infectious Diseases Outpatient Clinic of the Botucatu Medical School Hospital, São Paulo State University. Of these 73 individuals, 22 presented with the cardiac form of CD and 51 presented with the indeterminate form. The subjects with the chronic indeterminate and cardiac clinical forms of CD were divided into two groups for evaluation and comparison.

This study was approved by the Research Ethics Committee of the Botucatu Medical School Hospital ‒ UNESP (Opinion n° 6.333.295). Participants gave their consent to take part in the study after receiving information and clarification on the objectives of the previous study. Then, they signed of the informed consent form.

This study included adult male patients in the chronic phase of CD with the cardiac and indeterminate clinical forms. The patients were treated at the General Infectious Diseases Outpatient Clinic of the Botucatu Medical School Hospital at São Paulo State University. The patients provided written informed consent and granted the use of biological samples for further studies.

Two study groups were formed: indeterminate and cardiac.

Patients classified as indeterminate presented positive serology in at least two methods (chemiluminescence, hemagglutination or indirect immunofluorescence) and had normal Electrocardiograms (ECG), opaque enemas, and Esophagus-Stomach-Dodenum (EED), as well as an absence of clinical symptoms. Patients with the cardiac form were individuals who, in addition to positive serology, presented with ECG changes, chest X-Ray changes and clinical symptoms such as palpitations, arrhythmias, including ventricular extrasystole, tachycardia and different degrees of heart block.

Female patients were excluded due to the location of the ACE2 gene on the X chromosome. Detecting the polymorphism would require analyzing both XX chromosomes of maternal and paternal origin, necessitating heterozygosity control and greater interpretive complexity. Future studies should aim to include female patients. Additionally, hormonal influences, such as contraceptive use, should be considered. Individuals who refused to participate, those with inadequate biological material, and individuals who were deceased at the time of sample collection were excluded.

The following the clinical data was obtained from the medical record were age (years), weight (kg), height (m), Body Mass Index (BMI), drugs for hypertension, dyslipidemia and hyperglycemia medications used by the patient, blood pressure, cholesterol values and fractions, and blood glucose values.

BMI was calculated by dividing weight in kilograms by height in meters squared (kg/m2). For adults aged 20- to 59-years, the classification was based on the following values: < 18.5 = Underweight, 18.5–24.9 = Normal weight, 25–29.9 = Overweight, ≥ 30 = Obese.8

The following values were considered in the biochemical tests for the classification of the severity of comorbidities: diabetes, total cholesterol; High Density Lipoprotein (HDL) and triglycerides. Blood glucose > 126 mg/dL; total cholesterol > 239 mg/dL, normal HDL between 40 mg/dL and 60 mg/dL, and triglycerides > 200 mg/dL.9,10 In addition, the continuous use of drugs to control these comorbidities was evaluated.

Isolated systolic hypertension was defined as a systolic blood pressure ≥ 130 mmHg and a diastolic blood pressure < 80 mmHg. Isolated diastolic hypertension was defined as a systolic blood pressure < 130 mmHg and diastolic blood pressure ≥ 80 mmHg, as well as the use of antihypertensive medications.11

DNA was extracted from peripheral white blood cells. Five milliliters of peripheral blood were collected from the study participants by venipuncture in the antecubital fossa, using sterile and disposable needles and vacuum tubes. One millimiter of red cell lysis buffer RCLB (pH = 7.6, 1X, containing 10 mM Tris; 5 mM MgCl2 and 10 mM NaCl) was added to the leukocyte pellet which was then centrifuged at 15,000 rpm for 10 min. The supernatant was discarded, and the pellet stored at −20°C.

DNA was extracted using PureLink® Genomic DNA Mini Kits K182001 Kit (Invitrogen, Carlsbad, USA), according to the manufacturer's guidelines. The amount of DNA was determined using a NanoVue Plus spectrophotometer (GE Healthcare, Little Chalfont, Buckinghamshire, UK).

All samples were analyzed by conventional PCR. The primers used to amplify TNF rs1800629 were the forward primer GAGGCAATAGGTTTTGAGGGCCAT and the reverse primer GGGACACACAAGCATCAAG. The PCR reaction and cycling conditions of this first reaction followed the steps described by Asghar et al.12 The PCR products were monitored by electrophoresis on a 2 % agarose gel, stained with 1 µL of ethidium bromide. The gel was visualized and photographed using an Ultraviolet transluminator (UVP, Upaland, CA, USA) to confirm single-band amplification.

To evaluate the TNF rs1800629, 10 μL of the amplified PCR product and 0.5 μL of the restriction enzyme Nocardia corallina (NcoI) (New England BioLabs, Boston, MA, USA ‒ R0193L) were used. Digestion was performed at 37°C in a thermocycler for 2h, followed by 65°C for 10 min. The digested samples were examined on a 3 % agarose gel under an ultraviolet transilluminator. The genotypes were differentiated by the size of their fragments: GG: 126 and 21 bp, GA: 147, 126 and 21 bp and AA: 147 bp.

All samples were analyzed by conventional PCR. The primers used to evaluate the ACE2 rs2074192 were the (Forward) GTAAGCCATTTCCCATCCC and primer (Reverse) ATTGTGCCACTGCCCTCTA. The PCR reaction and cycling conditions for this second reaction were performed as described by Fan et al.11 The PCR products were monitored by electrophoresis on a 2 % agarose gel, stained with 1 µL of ethidium bromide. The gel was then visualized and photographed using an Ultraviolet transluminator (UVP, Upaland, CA, USA) to confirm single-band amplification. An approximately 500 bp product was generated and subsequently sequenced using the Sanger method.

Qualitative data were analyzed using either the Chi-Square test or Fischer's Exact Test, depending on the values in the contingency tables. For quantitative data, parametric analyses were performed. Student’s t-test was used for variables with normal distribution, and the Mann-Whitney test was used for variables with asymmetric distribution. A significance level of 0.05 was adopted for the p-value.

Of the total participants, 51 presented with the indeterminate form, and 22 presented with the cardiac form.

All 73 patients with Chagas disease were from rural areas in the state of São Paulo, Brazil. They were grouped by microregions of the State, with a focus on the subregions of Avaré (47) and Botucatu (18) (Fig. 1).

Fig. 1.

Map of the origin of patients with Chagas disease in the state of São Paulo. Indeter, Undetermined form; Card, Cardiac form; n, Number of patients belonging to each sub-region.

Most patients in this study, most patients resided in cities within the Avaré sub-region, 64.4 % (n=47) of the total of 73 patients, while 35.6 % were from other regions. Of the 51 patients with Chagas disease in the Avaré sub-region, 64.7 % (n=33) had the indeterminate form and 63.6 % (n=14) had the cardiac form. Itaí had the most patients with indeterminate forms 13.7 % (n=7), followed by Itaporanga 11.7 % (n=6); these two municipalities are part of the Avaré subregion. Among patients with the cardiac form, Bofete (Botucatu subregion) and Taquarituba (Avaré subregion) accounted for 13.6 % (n=3) of cases each.

There were no significant differences in BMI values between the two groups. This may be due to the outpatient follow-up provided at the Tropical Diseases Outpatient Clinic of the Botucatu Medical School Hospital, São Paulo State University (UNESP). Comorbidities are diagnosed and managed during outpatient follow-up of patients with CD (Table 1).

The mean age of individuals with the indeterminate and cardiac forms ranged from 68- to 70-years. There was no statistical difference between the groups and all individuals were classified as elderly.

Of the evaluated comorbidities, only hypercholesterolemia showed a statistically significant difference (Table 2).

Patients were classified as obese if their BMI was greater than 30. Of the 51 asymptomatic patients, 8 (15.7 %) were obese, and of the 22 patients with the symptomatic form, 4 (18.2 %) were also considered obese. There was no statistical difference between the groups or time points evaluated (p>0.05). The remaining patients were considered non-obese with BMI of <30. One patient (1.9 %) had low weight for the indeterminate form, and two patients (9.1 %) had low weight for the cardiac form. Those with normal weight represented about 18 % (35.3 %) for the indeterminate form and 10 % (45.4 %) for the cardiac form. Twenty-four individuals (47.1 %) with the indeterminate form and seven individuals (31.8 %) with the cardiac form were classified as overweight.

Fig. 2 shows the distribution of up to three comorbidities among the clinical forms of CD, represented using a Venn diagram.

Fig. 2.

. Hypercholesterolemia diabetes diagram of the frequency of up to three comorbidities in the clinical forms.

Table 3 presents the medications used continuously to treat Hypertension (AH), hypercholesterolemia, and diabetes/hyperglycemia. These drugs were found in the electronic medical records and helped identify each patient's comorbidities.

Regarding the ACE2 gene polymorphism genotypes between groups, the G allele was more prevalent in individuals with the indeterminate form (Table 4). When genotypes were analyzed within the asymptomatic and symptomatic groups, genotype G was more prevalent (Table 4). No significant differences were observed in the distribution of G and A genotypes between or within groups (p>0.05).

There were no significant associations between genotypes and comorbidities (see Table 5). It is important to note that some samples could not be sequenced due to insufficient biological material or contamination.

Regarding the results of the TNF-alpha gene genotypes. No significant differences were found in the distribution of GG, GA, and AA genotypes between the indeterminate and cardiac forms (Tables 6 and 7).