Thyroiditis were classified based on the American Thyroid Association definition. Based on clinical, laboratory, and ultrasonography findings, 151 patients with a definite diagnosis of HT, 59 patients with non-autoimmune thyroid disorders, and 32 subjects with normal thyroid gland function were included in the study. To confirm the results, thyroid function tests were repeated prior to taking any drug that could possibly affect thyroid function. None of them had concomitant diseases.

The patients were initially diagnosed with thyroiditis in routine clinical practice by general practitioners and referred to the endocrinology clinic of the University Hospital for further investigation. The study was approved by the University Ethics Committee. Informed consent was collected from all participants before sample collection.

Blood samples were collected in serum gel separator tubes and were then centrifuged to separate the serum and stored in a sterile tube at −20°C until use.

Serum TSH (normal range, 0.3–5.3μIU/mL), free T3 (normal range, 1.9–5.7pmol/L), free T4 (normal range, 10–22pmol/L), thyroid peroxidase antibodies (anti-TPO normal range, <35IU/mL), and thyroglobulin antibodies (Tg Ab<115IU/mL) were measured in all subjects by using an immuno-chemiluminescence technique (Cobas E411 system). Anti-HHV-6 antibody in the serum samples was determined by enzyme immunoassay according to the manufacturer's instruction (Biotin, Dublin, Ireland) as described before.11 An index value for HHV-6 antibody in serum samples for both patient and control samples was calculated as suggested by the manufacturer (Biotin).

Total DNA was isolated from the serum samples with the use of DNeasy Blood & Tissue Kit (Qiagen, Germany) according to the manufacturer's protocol. The DNA was then re-suspended in a final elution buffer volume of 50μL and stored at −20°C until further analysis.

The presence of HHV-6 DNA in serum samples was detected by nested PCR with primers designed to specifically targeting U67 gene in a region, a conserved between HHV-6A and HHV-6B. For the amplification of HHV-6 DNA, the outer primers (PF1: 5′GCTAGAACGTATTTGCTG3′; PR1: 5′ACAACTGTCTGACTGGCA3′) which amplify a fragment of 252 base pairs (bp) and the inner primers (PF2: 5′CTCAAGATCAACAAGTTG3′; PR2: 5′TCACGCACATCGGTATAT3′) which amplify a fragment of 154bp were used. Primer-BLAST was performed to check the specificity of the primers (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).

For the amplification of target genes, PCR was run in two separate steps. To amplify a 154bp DNA fragment of the major capsid protein (MCP) of HHV-6A and HHV-6B genotype genes, the first round of PCR amplification was carried out with 2μL of extracted DNA from serum samples, 1× PCR master mix, and 0.5μM of each outer primers in a final volume of 20μL. To construct the plasmid control for HHV-6A and HHV-6B, the PCR product fragments of HHV-6A and HHV-6B isolated from clinical samples and confirmed by DNA sequencing, U67 fragments were amplified as follows: initial denaturation at 95°C for 5min, 35 cycles of 95°C for 30s, 50°C for 30s, and 72°C for 30s, followed by a final extension at 72°C for 5min.

The second round of PCR was performed as mentioned for the first round, except that one microliter of the first PCR product was added to the second PCR reaction mixture. The PCR products were analyzed on 2% agarose gel electrophoresis and stained with GelRed TM (Biotium, UK), and visualized under UV light.

To test for possible plasmid contamination, PCR reaction was performed using T7 universal primer of pTZ57R/T vector 5′TAATACGACTCACTATAGGG3′ and PF1 primer of HHV-6 5′GCTAGAACGTATTTGCTG3′ that amplify a 320bp fragment including a portion of HHV-6 and T7 promoter sequences. In addition, extensive precautions were used to prevent PCR contamination. To ensure efficient DNA extraction and PCR amplification, a 177-bp fragment of the human β-actin gene was amplified together with the samples using 5′ATCGTGCGTGACATTAAGGAG3′ and 5′GAAGGAAGGCTGGAAGAGTG3′ primers.

To evaluate the sensitivity of HHV-6 PCR detection, a set of serum sample negative for HHV-6A and HHV-6B DNA were spiked with known 10-fold serial dilutions of HHV-6 A and HHV-6B DNA in a separate reaction. After DNA extraction, two stages of consecutive amplification were used for each virus separately. The product of the first-round amplification (252bp) was used as targets for the second round of nested PCR (154bp) amplification. The last positive dilution of the first-round PCR product (252bp) and dilutions which in the first round PCR failed to yield a PCR product were used as targets for the determination of the second round of nested PCR sensitivity test (154bp). The amplified products were then analyzed by gel electrophoresis and GelRedTM (Biotium, USA) post-staining.

To investigate the specificity of PCR, the amplified products were subjected to nucleotide sequencing analysis. To verify the accuracy of sequence determination, each nested PCR product was gel purified and cloned into pTZ57R/T plasmid vector. Sequence analysis was performed (150–200ng/μL) in both forward and reverse directions using specific primers by ABI 3730XL DNA analyzer (Bioneer, Inc.).

A 154bp fragment of the U67 gene was amplified. This fragment includes an XhoI restriction site in the HHV-6A genome absent in type B. XhoI digestion was performed on the PCR product, producing two fragments of 105 and 49bp for HHV-6A. The procedure was performed according to the manufacturer's instruction (Thermo scientific).

Statistical analysis was performed using SPSS software version 18 (SPSS Inc., Chicago, IL, USA). Pearson Chi-Square and Likelihood Ratio were used to determine any relation between the variables. Two-tailed p-values<0.05 were considered as statistically significant.

Overall, 242 patients were enrolled in the study. The demographic characteristics of patients and the results of thyroid function tests are shown in Table 1.

For the whole study group, there was a significant difference between age and TSH levels of participants (p<0.05). In addition, a significant correlation between age and the levels of FT3, FT4, anti-TPO, and anti-Tg (p<0.01) was found.

Anti-HHV-6 IgG antibody was detected in 69.5% of patients with HT, in 77.8%, patients with non-autoimmune thyroid disorders, and in 40.6% of euthyroid subjects. Based on anti-HHV-6 antibody detection, there was a significant difference between euthyroid subjects and patients suffering from thyroid dysfunctions (p<0.001).

Serum samples collected from 151 HT patients and 59 patients with non-autoimmune thyroid disorders as well as 32 euthyroid patients were analyzed for the presence of HHV-6 DNA by nested PCR using primers specific for a highly conserved sequence of U67 gene corresponding to the major capsid protein gene of HHV-6A/B. When evaluated by gel electrophoresis and GelRed staining, the lower limits of detection using nested PCR assay for HHV-6A/B DNA were determined to be five copies/reaction of HHV-6A or HHV-6B DNA.

To ensure impartiality, and avoid errors arising from bias, all the samples were analyzed in double-blind tests. HHV-6 DNA was detected in the serum sample of 57 out of 151 (38%) patients with HT, in contrast to five out of 59 (8%) patients with non-autoimmune thyroid disorders and 0/32 (0%) in euthyroid subjects. The prevalence of HHV-6 DNA in HT patients compared to that of the two other control groups was significantly different (p=0.001). Distribution of HHV-6 DNA in serum samples of the patients is shown in Table 1.

The primers were not able to differentiate between the two types on the basis of the size of the PCR product. For discriminating between HHV-6A and HHV-6B, restriction endonuclease XhoI and nucleotide sequences were used. In all samples positive for HHV-6 DNA detected in patients either with HT or non-autoimmune thyroiditis diseases, where accurate typing result was achieved, the virus was HHV-6 type A.

In addition, the obtained sequences were subjected to a BLAST search against the GenBank database for the HHV-6A (accession no. NC_001664.4) and HHV-6B (GenBank accession no. MH698402.1) (Fig. 1). A type was assigned to each sample based on the homology of our sequence data with published sequences in GenBank as shown in Fig. 1.

Fig. 1.

Alignment of patients’ samples sequence with HHV-6A (NC_001664.4) and HHV-6B (MH698402.1) sequences in the GenBank database. Underlined letters indicate the position of the restriction site sequence.

(0.37MB).

The study was approved by the Ethics Committee of Shiraz University of Medical Sciences and has therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments.

Informed consent was obtained from all individual participants included in the study.