was read the article
array:24 [ "pii" => "S1413867018310535" "issn" => "14138670" "doi" => "10.1016/j.bjid.2018.11.002" "estado" => "S300" "fechaPublicacion" => "2018-11-01" "aid" => "859" "copyright" => "Sociedade Brasileira de Infectologia" "copyrightAnyo" => "2019" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "sco" "cita" => "Braz J Infect Dis. 2018;22:495-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1478 "formatos" => array:3 [ "EPUB" => 128 "HTML" => 855 "PDF" => 495 ] ] "itemSiguiente" => array:19 [ "pii" => "S1413867018306238" "issn" => "14138670" "doi" => "10.1016/j.bjid.2018.11.004" "estado" => "S300" "fechaPublicacion" => "2018-11-01" "aid" => "861" "copyright" => "Sociedade Brasileira de Infectologia" "documento" => "simple-article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "crp" "cita" => "Braz J Infect Dis. 2018;22:499-502" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1922 "formatos" => array:3 [ "EPUB" => 125 "HTML" => 1472 "PDF" => 325 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Case report</span>" "titulo" => "Chronic skull osteomyelitis due to <span class="elsevierStyleItalic">Cryptococcus neoformans</span>: first case report in an HIV-infected patient" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "499" "paginaFinal" => "502" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2124 "Ancho" => 2500 "Tamanyo" => 717613 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">(A) External aspect of the scalp and skull lesion in an HIV-infected patient with chronic skull osteomyelitis due to <span class="elsevierStyleItalic">Cryptococcus neoformans</span>; (B) computed tomography scan of the patient's skull at admission showing paramenyngeal reaction with osteolytic parieto-occipital erosion; (C) three-dimensional reconstruction of the cranial lesion; (D) Grocott-Gomori methenamine-silver stain showing fungal structures compatible with Cryptococcus.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Natanael Sutikno Adiwardana, Juliana de Angelo Morás, Leandro Lombo Bernardo, Giselle Burlamaqui Klautau, Wladimir Queiroz, Jose Ernesto Vidal" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Natanael Sutikno" "apellidos" => "Adiwardana" ] 1 => array:2 [ "nombre" => "Juliana de Angelo" "apellidos" => "Morás" ] 2 => array:2 [ "nombre" => "Leandro Lombo" "apellidos" => "Bernardo" ] 3 => array:2 [ "nombre" => "Giselle Burlamaqui" "apellidos" => "Klautau" ] 4 => array:2 [ "nombre" => "Wladimir" "apellidos" => "Queiroz" ] 5 => array:2 [ "nombre" => "Jose Ernesto" "apellidos" => "Vidal" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867018306238?idApp=UINPBA00003Y" "url" => "/14138670/0000002200000006/v3_201903080640/S1413867018306238/v3_201903080640/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S141386701830970X" "issn" => "14138670" "doi" => "10.1016/j.bjid.2018.12.001" "estado" => "S300" "fechaPublicacion" => "2018-11-01" "aid" => "863" "copyright" => "Sociedade Brasileira de Infectologia" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Braz J Infect Dis. 2018;22:487-94" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1173 "formatos" => array:3 [ "EPUB" => 95 "HTML" => 795 "PDF" => 283 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Molecular characteristics and virulence gene profiles of <span class="elsevierStyleItalic">Staphylococcus aureus</span> causing bloodstream infection" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "487" "paginaFinal" => "494" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1269 "Ancho" => 1538 "Tamanyo" => 113673 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">The proportions of MRSA among all <span class="elsevierStyleItalic">S. aureus</span> isolates and the prevalence of ST239 or ST5 clone.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Xuehan Li, Fang Fang, Jin Zhao, Ning Lou, Chenglin Li, Tao Huang, Yirong Li" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Xuehan" "apellidos" => "Li" ] 1 => array:2 [ "nombre" => "Fang" "apellidos" => "Fang" ] 2 => array:2 [ "nombre" => "Jin" "apellidos" => "Zhao" ] 3 => array:2 [ "nombre" => "Ning" "apellidos" => "Lou" ] 4 => array:2 [ "nombre" => "Chenglin" "apellidos" => "Li" ] 5 => array:2 [ "nombre" => "Tao" "apellidos" => "Huang" ] 6 => array:2 [ "nombre" => "Yirong" "apellidos" => "Li" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S141386701830970X?idApp=UINPBA00003Y" "url" => "/14138670/0000002200000006/v3_201903080640/S141386701830970X/v3_201903080640/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Brief communication</span>" "titulo" => "Molecular types of <span class="elsevierStyleItalic">Cryptococcus</span> species isolated from patients with cryptococcal meningitis in a Brazilian tertiary care hospital" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "495" "paginaFinal" => "498" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Fernanda Wirth, Maria Isabel Azevedo, Luciano Z. Goldani" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Fernanda" "apellidos" => "Wirth" ] 1 => array:2 [ "nombre" => "Maria Isabel" "apellidos" => "Azevedo" ] 2 => array:4 [ "nombre" => "Luciano Z." "apellidos" => "Goldani" "email" => array:1 [ 0 => "lgoldani@ufrgs.br" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "Universidade Federal do Rio Grande do Sul, Hospital de Clínicas de Porto Alegre, Unidade de Doenças Infecciosas, Porto Alegre, RS, Brazil" "identificador" => "aff0005" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "<span class="elsevierStyleItalic">Corresponding author</span>." ] ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">Cryptococcosis is a systemic mycosis primarily caused by <span class="elsevierStyleItalic">Cryptococcus neoformans</span> species complex. The <span class="elsevierStyleItalic">C. neoformans</span> complex includes the molecular types VNI, VNII, VNB, VNIII, and VNIV, and the <span class="elsevierStyleItalic">C. gattii</span> species complex, which includes the molecular types VGI, VGII, VGIII, and VGIV.<a class="elsevierStyleCrossRefs" href="#bib0170"><span class="elsevierStyleSup">1,2</span></a> Members of the <span class="elsevierStyleItalic">C. neoformans</span> species complex are responsible for most cases of cryptococcosis associated with AIDS. Using genotyping techniques four major molecular types can be identified VNI, VNII, VNB, VNIV, in addition to the AD hybrid. VNI and VNII have a worldwide distribution.<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">3</span></a> In terms of serotypes, three varieties are recognized: <span class="elsevierStyleItalic">C. neoformans</span> var. <span class="elsevierStyleItalic">grubii</span>, serotype A, <span class="elsevierStyleItalic">C. neoformans</span> var. <span class="elsevierStyleItalic">neoformans</span>, serotype D, <span class="elsevierStyleItalic">C. neoformans</span> var. <span class="elsevierStyleItalic">gattii</span>, serotypes B and C, and the hybrid serotype AD.<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">4–6</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Meningitis is the most serious infectious due to <span class="elsevierStyleItalic">Cryptococcus</span> sp. The human immunodeficiency virus (HIV)/AIDS pandemic increased the population of immunosupressed and susceptible individuals and brought an increase <span class="elsevierStyleItalic">in C. neoformans</span> infection rates, but the increasing number of people living with any other immunodeficiency, including transplant and cancer patients, represents a growing population at risk for cryptococcosis.<a class="elsevierStyleCrossRefs" href="#bib0200"><span class="elsevierStyleSup">7,8</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">The recent availability of DNA fingerprinting techniques extended our knowledge about <span class="elsevierStyleItalic">C. neoformans</span> epidemiology over the past years. Naturally, the randomized amplified polymorphic DNA, PCR-fingerprinting, restriction fragment length polymorphism, karyotyping, allele sequencing, and multilocus enzyme electrophoresis helped us to answer several questions. PCR fingerprinting technique has been used as the major typing technique in the ongoing global molecular epidemiologic survey of <span class="elsevierStyleItalic">C. neoformans</span>, dividing >400 clinical and environmental isolates into eight major molecular types: VNI (var. grubii, serotype A), VNII (var. grubii, serotype A), VNIII (serotype AD), VNIV (var. neoformans, serotype D), VGI, VGII, VGIII, and VGIV (var. gattii, serotypes B and C). No correlation between serotype and molecular type has been found for <span class="elsevierStyleItalic">C. neoformans var. gattii.</span> The molecular types were recently confirmed by RFLP analysis of the orotidine monophosphate pyrophosphorylase (URA5) gene and the phospholipase (PLB1) gene.<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">9–13</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Currently, there are limited data on the molecular epidemiology of cryptococcosis in Brazil. Here, we report on the identification of the molecular pattern of the <span class="elsevierStyleItalic">Cryptococcus</span> species that caused meningitis in patients admitted in a reference Brazilian tertiary care hospital, and review the published studies addressing the molecular epidemiology of <span class="elsevierStyleItalic">Cryptococcus</span> in Brazil.</p><p id="par0025" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Cryptococcus sp</span>. was isolated from the cerebrospinal fluid of patients with meningoencephalitis admitted at Hospital de Clinicas de Porto Alegre, 700-bed tertiary Brazilian reference hospital, from January 2014 to December 2015. Initially, <span class="elsevierStyleItalic">C. neoformans</span> and <span class="elsevierStyleItalic">C. gattii</span> were distinguished by a phenotypic method – CGB agar (cavanine glycine bromothymol blue agar). Detailed demographics, risk factors, treatment regimens and clinical outcome of the patients with meningeal cryptococcosis were evaluated from medical records. The study was approved by the local ethics committee. <span class="elsevierStyleItalic">Cryptococcus</span> complex reference strains were very kindly provided by Laboratory of Mycology (Pathogenic Fungi Collection), at Oswaldo Cruz Foundation (FIOCRUZ) – INI/FIOCRUZ in Brazil. The strains included were the following: WN<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>M 148 (VNI, serotype A), WM 626 (VNII, serotype A), WM 628 (VNIII, serotype AD), WM 629 (VNIV, serotype D), WM 179 (VGI, serotype B), WM 178 (VGII, serotype B), WM 161 (VGIII, serotype B) and WM 779 (VGIV, serotype C). The extraction of genomic DNA and RFLP analysis was performed according protocol using 2 primers: URA5 (5′ATGTCCTCCCAAGCCCTCGACTCCG3′) and SJ01 (5′ TTAAGACCTCTGAACACCGTACTC3′). RFLP patterns were assigned visually by comparing them to the patterns obtained from the standard-type strains (VNI-VNIV and VGI-VGIV).<a class="elsevierStyleCrossRefs" href="#bib0235"><span class="elsevierStyleSup">14,15</span></a></p><p id="par0030" class="elsevierStylePara elsevierViewall">Fifteen patients with cryptococcal meningoencephalitis were evaluated in the study (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>). The gene URA-5 RFLP showed that nine patients had VNII, serotype A, two patients VNI serotype A, and two had VGII, serotype B isolate from their CSF samples. Two patients presented a positive CSF cryptococcal polysaccharide antigen, and <span class="elsevierStyleItalic">Cryptococcus</span> could not be isolated from the CSF samples. As expected, the VNII, serotype A strains were isolated from patients with underlying immunossupressive disease. HIV positive was the most common condition, followed by kidney and liver transplant. Meningoencephalitis by <span class="elsevierStyleItalic">C. gattii</span> was diagnosed in two patients. One of them was immunocompetent and the other presented an immunosuppressive condition (HIV). Clinical isolates were highly susceptible to amphotericin B and fluconazole by microdilution method (data not shown). In Brazil, studies of the <span class="elsevierStyleItalic">in</span><span class="elsevierStyleItalic">vitro</span> susceptibility of <span class="elsevierStyleItalic">Cryptococcus</span> spp. have shown that most isolates are susceptible to polyene antifungals, 5-flucytosine, and azoles.<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">16</span></a></p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">Although we analyzed a small number of isolates, our study has shown the predominance of VNII <span class="elsevierStyleItalic">Cryptococcus</span> genotype in patients with meningoencephalitis. Previous studies have shown that the VNI molecular pattern is the most common pattern worldwide, whereas VNII was observed in 1%–16% of cases reported in South America, Africa, and Oceania.<a class="elsevierStyleCrossRefs" href="#bib0250"><span class="elsevierStyleSup">17,2</span></a><span class="elsevierStyleItalic">C. gattii</span> VGII was also observed in South America, North America, and Oceania. <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a> describes the studies evaluating the <span class="elsevierStyleItalic">Cryptococcus</span> genotypes circulating in Brazil.<a class="elsevierStyleCrossRefs" href="#bib0255"><span class="elsevierStyleSup">18–33</span></a> Several regions exhibited a high prevalence of the VNI molecular type and sporadic cases of the VNII and VGII molecular types in Brazil. The predominance of the VNI molecular type has been described in the States of São Paulo, Minas Gerais, Mato Grosso, Amazonas, PIauí, Rio Grande do Sul and Rio de Janeiro in Brazil.</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0040" class="elsevierStylePara elsevierViewall">Studies of molecular types of <span class="elsevierStyleItalic">Cryptococcus</span> contribute to the evaluation of the epidemiology, clinical manifestations, interventions and therapeutic approach for cryptococcosis. The presence of molecular type VNII was reported in all five continents, but little is known about its pathobiology, ecology, and antifungal susceptibility. Therefore, tools that are able to identify it are important to better understand how it is distributed in the environment, how it interacts with the host, and finally if it needs a different and more specific treatment to improve the patient outcome. Additional studies of VNII isolates will contribute to understanding the epidemiology and phylogenetic relationship of this genotype compared to the other ones, revealing if it represents a separate species in the <span class="elsevierStyleItalic">C. neoformans</span> species complex.</p><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Conflicts of interest</span><p id="par0045" class="elsevierStylePara elsevierViewall">The authors declare no conflicts of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:5 [ 0 => array:3 [ "identificador" => "xres1161465" "titulo" => "Abstract" "secciones" => array:1 [ 0 => array:1 [ "identificador" => "abst0005" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1087691" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Conflicts of interest" ] 3 => array:2 [ "identificador" => "xack396595" "titulo" => "Acknowledgments" ] 4 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2018-10-12" "fechaAceptado" => "2018-11-10" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1087691" "palabras" => array:5 [ 0 => "Cryptococcus" 1 => "Genotypes" 2 => "Molecular types" 3 => "Epidemiology" 4 => "Brazil" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">There are limited data on the molecular epidemiology of cryptococcosis in Brazil. Here, we report on the identification of the molecular pattern of the <span class="elsevierStyleItalic">Cryptococcus</span> species that caused meningitis in patients admitted in a Brazilian reference tertiary care hospital, and review the published studies addressing the molecular epidemiology of Cryptococcus in Brazil. Our study has shown the predominance of molecular type VNII in HIV-infected patients with cryptococcal meningoencephalitis. Molecular types VNII and VGII were occasionally detected in HIV-infected and non-infected patients with meningoencephalitis. In contrast, previous studies have shown that several regions exhibited a high prevalence of the VNI molecular type and sporadic cases of the VNII and VGII molecular types in patients with cryptococcosis in Brazil. Additional studies including VNII isolates will contribute to understanding the epidemiology and phylogenetic relationship of these genotype compared to the other ones. So far, no clear correlation has been established between genotypes, antifungal susceptibility for <span class="elsevierStyleItalic">Cryptococcus</span> and clinical outcome in cryptococcosis.</p></span>" ] ] "multimedia" => array:2 [ 0 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">M, male; F, female; AmB, amphotericin B deoxycholate; FLZ, fluconazole; VCZ, voriconazole.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="" valign="top" scope="col" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Age/Sex \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Species complex \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Molecular type \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Underlying disease \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Treatment \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Outcome \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">54/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Kidney transplant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Liposomal AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">6/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Liver transplant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>5-FC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">45/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Not available \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Not available \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">27/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">65/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. gattii</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII, Serotype B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Immunocompetent \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ (VCZ) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">33/F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Kidney transplant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">42/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">55/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">62/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Kidney transplant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">25/F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">38/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Lipid complex AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">44/F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Alive \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">37/F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. neoformans</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, Serotype A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">14 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">41/M \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><span class="elsevierStyleItalic">C. gattii</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII, Serotype B \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="char" valign="top">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">43/F \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Not available \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Not available \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">HIV+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AmB<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>FCZ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Death \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1982746.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Cryptococcus</span> species complex and genotype identification in the CSF samples from patients with cryptococcal meningitis.</p>" ] ] 1 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "<p id="npar0005" class="elsevierStyleSimplePara elsevierViewall">RS, Rio Grande do Sul; SP, São Paulo; MS, Mato Grosso do Sul; MG, Minas Gerais; BA, Bahia; PI, Piauí; PE, Pernambuco; RR, Roraima; AM, Amazonas.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Reference \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Location – state \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Predominant molecular type \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Other molecular types \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Wirth et al. (present case) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Rio Grande do Sul \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Nunes et al.<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">18</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Mato Grosso do Sul \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Andrade-Silva et al.<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">19</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Minas Gerais \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Aguiar et al.<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">20</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Minas Gerais \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, VGI \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Ferreira-Paim et al.<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">21</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Minas Gerais \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="" valign="top"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Figueiredo et al.<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">22</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">São Paulo \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Favalessa et al.<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">23</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Mato Grosso \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Freire et al.<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">24</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Amazonas \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Matos et al.<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">25</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Bahia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">da Silva et al.<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">26</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Amazonas \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Martins et al.<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">27</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Piauí \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Mora et al.<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">28</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Minas Gerais \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Souza et al.<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">29</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Goias \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Triles et al.<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">30</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">RS, SP, MS, MG, BA PI, PE, RR, AM \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, VGII \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII, VNIII, VNIV, VGI, VGIII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Matsumoto et al.<a class="elsevierStyleCrossRef" href="#bib0320"><span class="elsevierStyleSup">31</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">São Paulo \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Igreja et al.<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">32</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Rio de Janeiro \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI, VNII \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGI, VGII \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Casali et al.<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">33</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Rio Grande do Sul \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VNI \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">VGIII \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1982747.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Studies addressing the prevalence of <span class="elsevierStyleItalic">Cryptococcus</span> molecular types in cryptococcosis in Brazil.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:33 [ 0 => array:3 [ "identificador" => "bib0170" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The case for adopting the “species complex” nomenclature for the etiologic agents of cryptococcosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "K.J. Kwon-Chung" 1 => "J.E. Bennett" 2 => "B.L. Wickes" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "mSphere" "fecha" => "2017" "volumen" => "2" "paginaInicial" => "e00357" "paginaFinal" => "e416" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0175" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IberoAmerican Cryptococcal Study Group Molecular typing of IberoAmerican <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "W. Meyer" 1 => "A. Castañeda" 2 => "S. Jackson" 3 => "M. Huynh" 4 => "E. Castañeda" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Emerg Infect Dis" "fecha" => "2003" "volumen" => "9" "paginaInicial" => "189" "paginaFinal" => "195" "itemHostRev" => array:3 [ "pii" => "S0022395609001757" "estado" => "S300" "issn" => "00223956" ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0180" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multilocus sequence typing of serially collected isolates of <span class="elsevierStyleItalic">Cryptococcus</span> from HIV-infected patients in South Africa" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Van Wyk" 1 => "N.P. Govender" 2 => "T.G. Mitchell" 3 => "A.P. Litvintseva" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2014" "volumen" => "52" "paginaInicial" => "1921" "paginaFinal" => "1931" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0185" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A new genus, <span class="elsevierStyleItalic">Filobasidiella</span>, the perfect state of <span class="elsevierStyleItalic">Cryptococcus neoformans</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "K.J. Kwon-Chung" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mycologia" "fecha" => "1975" "volumen" => "67" "paginaInicial" => "1197" "paginaFinal" => "1200" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/765816" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0190" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A new genus, <span class="elsevierStyleItalic">Filobasidiella</span>, the sexual state of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> B and C serotypes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "K.J. Kwon-Chung" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mycologia" "fecha" => "1976" "volumen" => "68" "paginaInicial" => "942" "paginaFinal" => "946" ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0195" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Casadevall A <span class="elsevierStyleItalic">Cryptococcus neoformans</span> var. <span class="elsevierStyleItalic">grubii</span>: separate varietal status for <span class="elsevierStyleItalic">Cryptococcus neoformans</span> serotype A isolates" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.P. Franzot" 1 => "I.F. Salkin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1999" "volumen" => "37" "paginaInicial" => "838" "paginaFinal" => "840" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0200" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cryptococcosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E.K. Maziarz" 1 => "J.R. Perfect" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Infect Dis Clin North Am" "fecha" => "2016" "volumen" => "30" "paginaInicial" => "179" "paginaFinal" => "206" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0205" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> in Brazil and the United States: evidence for both local genetic differences and a global clonal population structure" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.P. Franzot" 1 => "J.S. Hamdan" 2 => "B.P. Currie" 3 => "A. Casadevall" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1997" "volumen" => "35" "paginaInicial" => "2243" "paginaFinal" => "2251" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9276395" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0210" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Restriction fragment length polymorphism analysis of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates from environmental (pigeon excreta) and clinical sources in New York City" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "B.P. Currie" 1 => "L.F. Freundlich" 2 => "A. Casadevall" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1994" "volumen" => "32" "paginaInicial" => "1188" "paginaFinal" => "1192" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0215" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Karyotyping of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> as an epidemiological tool" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.R. Perfect" 1 => "N. Ketabchi" 2 => "G.M. Cox" 3 => "C.W. Ingram" 4 => "C.L. Beiser" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1993" "volumen" => "31" "paginaInicial" => "3305" "paginaFinal" => "3309" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0220" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diversity of DNA fingerprints in <span class="elsevierStyleItalic">Cryptococcus neoformans</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Varma" 1 => "D. Swinne" 2 => "F. Staib" 3 => "J.E. Bennet" 4 => "K.J. Kwon-Chung" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1995" "paginaInicial" => "1807" "paginaFinal" => "1814" "itemHostRev" => array:3 [ "pii" => "S0140673603127055" "estado" => "S300" "issn" => "01406736" ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0225" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification by random amplification of polymorphic DNA of a common molecular type of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> var <span class="elsevierStyleItalic">neoformans</span> in patients with AIDS or other immunosuppressive conditions" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "S.C. Chen" 1 => "A.G. Brownlee" 2 => "T.C. Sorrel" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "J Infect Dis" "fecha" => "1996" "paginaInicial" => "754" "paginaFinal" => "758" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0230" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology: surveillance of fungal infections" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "D. Ellis" 1 => "D. Marriott" 2 => "R.A. Hajjeh" 3 => "D. Warnock" 4 => "W. Meyer" 5 => "R. Barton" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Med Mycol" "fecha" => "2000" "paginaInicial" => "173" "paginaFinal" => "182" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0235" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Global molecular epidemiology offers hints towards ongoing speciation within <span class="elsevierStyleItalic">Cryptococcus neoformans</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "W. Meyer" 1 => "S. Kidd" 2 => "A. Castañeda" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:3 [ "titulo" => "Abstracts of the 5th international conference on <span class="elsevierStyleItalic">Cryptococcus</span> and <span class="elsevierStyleItalic">Cryptococcosis</span>" "conferencia" => "Adelaide, Australia, March 3–7, 2002" "serieFecha" => "2002" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0240" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hybrid genotypes in the pathogenic yeast <span class="elsevierStyleItalic">Cryptococcus neoformans</span>" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "T. Boekhout" 1 => "B. Theelen" 2 => "M. Diaz" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Microbiology" "fecha" => "2001" "volumen" => "147" "paginaInicial" => "891" "paginaFinal" => "907" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0335" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:3 [ "comentario" => "<a class="elsevierStyleInterRef" target="_blank" id="intr0005" href="https://www.ncbi.nlm.nih.gov/pubmed/29461182">https://www.ncbi.nlm.nih.gov/pubmed/29461182</a>" "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular characterization and antifungal susceptibility testing of Cryptococcus neoformans sensu stricto from southern Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "P.F. Herkert" 1 => "Meis F F" 2 => "G. Lucca de Oliveira Salvador" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1099/jmm.0.000698" "Revista" => array:5 [ "tituloSerie" => "J Med Microbiol" "fecha" => "2018" "volumen" => "67" "paginaInicial" => "560" "paginaFinal" => "569" ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0250" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Global molecular epidemiology of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and <span class="elsevierStyleItalic">Cryptococcus gattii</span>: an atlas of the molecular types" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M. Cogliati" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Scientifica" "fecha" => "2013" "volumen" => "2013" "paginaInicial" => "1" "paginaFinal" => "23" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0255" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "<span class="elsevierStyleItalic">Cryptococcal meningitis</span> epidemiology: 17 years of experience in a State of the Brazilian Pantanal" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "J.O. Nunes" 1 => "R.A.S. Tsujisaki" 2 => "M.O. Nunes" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Soc Bras Med Trop" "fecha" => "2018" "volumen" => "51" "paginaInicial" => "485" "paginaFinal" => "492" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0260" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotypic analysis of clinical and environmental <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates from Brazil reveals the presence of VNB isolates and a correlation with biological factors" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "L.E. Andrade-Silva" 1 => "K. Ferreira-Paim" 2 => "T.B. Ferreira" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0193237" "Revista" => array:5 [ "tituloSerie" => "PLoS One" "fecha" => "2018" "volumen" => "13" "paginaInicial" => "e0193237" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29505557" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0265" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The epidemiology of cryptococcosis and the characterization of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolated in a Brazilian University Hospital" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "P.A.D.F. Aguiar" 1 => "R.D.S. Pedroso" 2 => "A.S. Borges" 3 => "T.A. Moreira" 4 => "L.B. Araújo" 5 => "D.V.D.B. Röder" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1590/S1678-9946201759013" "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "2017" "volumen" => "59" "paginaInicial" => "e13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28423088" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0270" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MLST-based population genetic analysis in a global context reveals clonality amongst <span class="elsevierStyleItalic">Cryptococcus neoformans var. grubii</span> VNI isolates from HIV patients in Southeastern Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "K. Ferreira-Paim" 1 => "L. Andrade-Silva" 2 => "F.M. Fonseca" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "PLoS Negl Trop Dis" "fecha" => "2017" "volumen" => "11" "paginaInicial" => "e0005223" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0275" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antifungal susceptibility testing and genotyping characterization of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and <span class="elsevierStyleItalic">gattii</span> isolates from HIV-infected patients of Ribeirão Preto, São Paulo, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "T.P. Figueiredo" 1 => "R.C. Lucas" 2 => "R.A. Cazzaniga" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1590/S1678-9946201658069" "Revista" => array:5 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "2016" "volumen" => "58" "paginaInicial" => "69" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27680174" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0280" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular typing and in vitro antifungal susceptibility of <span class="elsevierStyleItalic">Cryptococcus</span> spp from patients in Midwest Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "O.C. Favalessa" 1 => "D.A.J. de Paula" 2 => "V. Dutra" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3855/jidc.4446" "Revista" => array:7 [ "tituloSerie" => "J Infect Dev Ctries" "fecha" => "2014" "volumen" => "8" "paginaInicial" => "1037" "paginaFinal" => "1043" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25116671" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1935861X15009663" "estado" => "S300" "issn" => "1935861X" ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0285" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular characterisation of the causative agents of Cryptococcosis in patients of a tertiary healthcare facility in the state of Amazonas-Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "A.K. Freire" 1 => "A. dos Santos Bentes" 2 => "I. de Lima Sampaio" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1439-0507.2012.02173.x" "Revista" => array:6 [ "tituloSerie" => "Mycoses" "fecha" => "2012" "volumen" => "55" "paginaInicial" => "e145" "paginaFinal" => "e150" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22360142" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0290" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Microbiological characteristics of clinical isolates of <span class="elsevierStyleItalic">Cryptococcus</span> spp. in Bahia Brazil: molecular types and antifungal susceptibilities" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C.S. Matos" 1 => "A. de Souza Andrade" 2 => "N.S. Oliveira" 3 => "T.F. Barros" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "2012" "volumen" => "31" "paginaInicial" => "1647" "paginaFinal" => "1652" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0295" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of clinical isolates of the <span class="elsevierStyleItalic">Cryptococcus neoformans–Cryptococcus gattii</span> species complex from the Amazonas State in Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "B.K. Da Silva" 1 => "A.K. Freire" 2 => "S. Bentes Ados" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rev Iberoam Micol" "fecha" => "2012" "volumen" => "29" "paginaInicial" => "40" "paginaFinal" => "43" ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0300" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotypes of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and <span class="elsevierStyleItalic">Cryptococcus gattii</span> as agents of endemic cryptococcosis in Teresina Piauí (northeastern Brazil)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "L.M.S. Martins" 1 => "B. Wanke" 2 => "M.S. Lazéra" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2011" "volumen" => "106" "paginaInicial" => "725" "paginaFinal" => "730" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0305" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotype and mating type distribution within clinical <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and <span class="elsevierStyleItalic">Cryptococcus gattii</span> isolates from patients with cryptococcal meningitis in Uberaba, Minas Gerais, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "D.J. Mora" 1 => "A.L. Pedrosa" 2 => "V. Rodrigues" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Med Mycol" "fecha" => "2010" "volumen" => "48" "paginaInicial" => "561" "paginaFinal" => "569" "itemHostRev" => array:3 [ "pii" => "S016503271631789X" "estado" => "S300" "issn" => "01650327" ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0310" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular typing and antifungal susceptibility of clinical and environmental <span class="elsevierStyleItalic">Cryptococcus neoformans</span> species complex isolates in Goiania, Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "L.K. Souza" 1 => "A.H. Souza Junior" 2 => "C.R. Costa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mycoses" "fecha" => "2010" "volumen" => "53" "paginaInicial" => "62" "paginaFinal" => "67" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0315" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regional pattern of the molecular types of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> and <span class="elsevierStyleItalic">Cryptococcus gattii</span> in Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "L. Trilles" 1 => "M.S. Lazéra" 2 => "B. Wanke" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2008" "volumen" => "103" "paginaInicial" => "455" "paginaFinal" => "462" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18797758" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0193953X13000890" "estado" => "S300" "issn" => "0193953X" ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0320" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genotyping, serotyping and determination of mating-type of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> clinical isolates from São Paulo, state Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M.T. Matsumoto" 1 => "A.M. Fusco-Almeida" 2 => "L.C. Baeza" 3 => "M.S.C. Melhem" 4 => "M.J.S. Mendes-Giannini" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "2007" "volumen" => "49" "paginaInicial" => "41" "paginaFinal" => "47" "itemHostRev" => array:3 [ "pii" => "S0163834317301433" "estado" => "S300" "issn" => "01638343" ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0325" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular epidemiology of <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates from AIDS patients of the Brazilian city, Rio de Janeiro" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "R.P. Igreja" 1 => "M. Lazéra" 2 => "S. dos" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Med Mycol" "fecha" => "2004" "volumen" => "42" "paginaInicial" => "229" "paginaFinal" => "238" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15283237" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0330" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular typing of clinical and environmental <span class="elsevierStyleItalic">Cryptococcus neoformans</span> isolates in the Brazilian state Rio Grande do Sul" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:3 [ 0 => "A.K. Casali" 1 => "L. Goulart" 2 => "L.K.R. Silva" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S1567-1356(03)00038-2" "Revista" => array:7 [ "tituloSerie" => "FEMS Yeast Res" "fecha" => "2003" "volumen" => "3" "paginaInicial" => "405" "paginaFinal" => "415" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12748052" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S1935861X08000053" "estado" => "S300" "issn" => "1935861X" ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack396595" "titulo" => "Acknowledgments" "texto" => "<p id="par0050" class="elsevierStylePara elsevierViewall">The study was supported in part by CNPq (Brazilian National Council of Research).</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/14138670/0000002200000006/v3_201903080640/S1413867018310535/v3_201903080640/en/main.assets" "Apartado" => array:4 [ "identificador" => "10971" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Brief communication" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/14138670/0000002200000006/v3_201903080640/S1413867018310535/v3_201903080640/en/main.pdf?idApp=UINPBA00003Y&text.app=https://bjid.org.br/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1413867018310535?idApp=UINPBA00003Y" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 October | 12 | 11 | 23 |
2024 September | 33 | 15 | 48 |
2024 August | 49 | 35 | 84 |
2024 July | 63 | 28 | 91 |
2024 June | 67 | 28 | 95 |
2024 May | 31 | 22 | 53 |
2024 April | 42 | 34 | 76 |
2024 March | 47 | 26 | 73 |
2024 February | 30 | 23 | 53 |
2024 January | 31 | 23 | 54 |
2023 December | 36 | 32 | 68 |
2023 November | 34 | 35 | 69 |
2023 October | 24 | 35 | 59 |
2023 September | 44 | 48 | 92 |
2023 August | 30 | 19 | 49 |
2023 July | 28 | 19 | 47 |
2023 June | 23 | 14 | 37 |
2023 May | 43 | 22 | 65 |
2023 April | 43 | 14 | 57 |
2023 March | 93 | 28 | 121 |
2023 February | 62 | 30 | 92 |
2023 January | 20 | 15 | 35 |
2022 December | 80 | 23 | 103 |
2022 November | 37 | 37 | 74 |
2022 October | 88 | 34 | 122 |
2022 September | 39 | 52 | 91 |
2022 August | 37 | 39 | 76 |
2022 July | 33 | 47 | 80 |
2022 June | 35 | 39 | 74 |
2022 May | 29 | 54 | 83 |
2022 April | 37 | 72 | 109 |
2022 March | 55 | 83 | 138 |
2022 February | 51 | 67 | 118 |
2022 January | 29 | 68 | 97 |
2021 December | 43 | 72 | 115 |
2021 November | 47 | 70 | 117 |
2021 October | 24 | 57 | 81 |
2021 September | 25 | 44 | 69 |
2021 August | 26 | 31 | 57 |
2021 July | 14 | 24 | 38 |
2021 June | 29 | 32 | 61 |
2021 May | 37 | 53 | 90 |
2021 April | 73 | 116 | 189 |
2021 March | 35 | 43 | 78 |
2021 February | 31 | 55 | 86 |
2021 January | 23 | 59 | 82 |
2020 December | 24 | 51 | 75 |
2020 November | 27 | 57 | 84 |
2020 October | 26 | 31 | 57 |
2020 September | 30 | 56 | 86 |
2020 August | 24 | 29 | 53 |
2020 July | 17 | 20 | 37 |
2020 June | 21 | 9 | 30 |
2020 May | 32 | 17 | 49 |
2020 April | 17 | 12 | 29 |
2020 March | 22 | 24 | 46 |
2020 February | 48 | 50 | 98 |
2020 January | 42 | 43 | 85 |
2019 December | 24 | 42 | 66 |
2019 November | 28 | 18 | 46 |
2019 October | 36 | 28 | 64 |
2019 September | 48 | 18 | 66 |
2019 August | 47 | 55 | 102 |
2019 July | 58 | 9 | 67 |
2019 June | 96 | 21 | 117 |
2019 May | 158 | 22 | 180 |
2019 April | 83 | 44 | 127 |
2019 March | 117 | 76 | 193 |
2019 February | 36 | 33 | 69 |
2019 January | 37 | 38 | 75 |
2018 December | 9 | 8 | 17 |