Journal Information
Vol. 22. Issue 6.
Pages 495-498 (November - December 2018)
Share
Share
Download PDF
More article options
Visits
860
Vol. 22. Issue 6.
Pages 495-498 (November - December 2018)
Brief communication
DOI: 10.1016/j.bjid.2018.11.002
Open Access
Molecular types of Cryptococcus species isolated from patients with cryptococcal meningitis in a Brazilian tertiary care hospital
Visits
860
Fernanda Wirth, Maria Isabel Azevedo, Luciano Z. Goldani
Corresponding author
lgoldani@ufrgs.br

Corresponding author.
Universidade Federal do Rio Grande do Sul, Hospital de Clínicas de Porto Alegre, Unidade de Doenças Infecciosas, Porto Alegre, RS, Brazil
This item has received
860
Visits

Under a Creative Commons license
Article information
Abstract
Full Text
Bibliography
Download PDF
Statistics
Tables (2)
Table 1. Cryptococcus species complex and genotype identification in the CSF samples from patients with cryptococcal meningitis.
Table 2. Studies addressing the prevalence of Cryptococcus molecular types in cryptococcosis in Brazil.
Show moreShow less
Abstract

There are limited data on the molecular epidemiology of cryptococcosis in Brazil. Here, we report on the identification of the molecular pattern of the Cryptococcus species that caused meningitis in patients admitted in a Brazilian reference tertiary care hospital, and review the published studies addressing the molecular epidemiology of Cryptococcus in Brazil. Our study has shown the predominance of molecular type VNII in HIV-infected patients with cryptococcal meningoencephalitis. Molecular types VNII and VGII were occasionally detected in HIV-infected and non-infected patients with meningoencephalitis. In contrast, previous studies have shown that several regions exhibited a high prevalence of the VNI molecular type and sporadic cases of the VNII and VGII molecular types in patients with cryptococcosis in Brazil. Additional studies including VNII isolates will contribute to understanding the epidemiology and phylogenetic relationship of these genotype compared to the other ones. So far, no clear correlation has been established between genotypes, antifungal susceptibility for Cryptococcus and clinical outcome in cryptococcosis.

Keywords:
Cryptococcus
Genotypes
Molecular types
Epidemiology
Brazil
Full Text

Cryptococcosis is a systemic mycosis primarily caused by Cryptococcus neoformans species complex. The C. neoformans complex includes the molecular types VNI, VNII, VNB, VNIII, and VNIV, and the C. gattii species complex, which includes the molecular types VGI, VGII, VGIII, and VGIV.1,2 Members of the C. neoformans species complex are responsible for most cases of cryptococcosis associated with AIDS. Using genotyping techniques four major molecular types can be identified VNI, VNII, VNB, VNIV, in addition to the AD hybrid. VNI and VNII have a worldwide distribution.3 In terms of serotypes, three varieties are recognized: C. neoformans var. grubii, serotype A, C. neoformans var. neoformans, serotype D, C. neoformans var. gattii, serotypes B and C, and the hybrid serotype AD.4–6

Meningitis is the most serious infectious due to Cryptococcus sp. The human immunodeficiency virus (HIV)/AIDS pandemic increased the population of immunosupressed and susceptible individuals and brought an increase in C. neoformans infection rates, but the increasing number of people living with any other immunodeficiency, including transplant and cancer patients, represents a growing population at risk for cryptococcosis.7,8

The recent availability of DNA fingerprinting techniques extended our knowledge about C. neoformans epidemiology over the past years. Naturally, the randomized amplified polymorphic DNA, PCR-fingerprinting, restriction fragment length polymorphism, karyotyping, allele sequencing, and multilocus enzyme electrophoresis helped us to answer several questions. PCR fingerprinting technique has been used as the major typing technique in the ongoing global molecular epidemiologic survey of C. neoformans, dividing >400 clinical and environmental isolates into eight major molecular types: VNI (var. grubii, serotype A), VNII (var. grubii, serotype A), VNIII (serotype AD), VNIV (var. neoformans, serotype D), VGI, VGII, VGIII, and VGIV (var. gattii, serotypes B and C). No correlation between serotype and molecular type has been found for C. neoformans var. gattii. The molecular types were recently confirmed by RFLP analysis of the orotidine monophosphate pyrophosphorylase (URA5) gene and the phospholipase (PLB1) gene.9–13

Currently, there are limited data on the molecular epidemiology of cryptococcosis in Brazil. Here, we report on the identification of the molecular pattern of the Cryptococcus species that caused meningitis in patients admitted in a reference Brazilian tertiary care hospital, and review the published studies addressing the molecular epidemiology of Cryptococcus in Brazil.

Cryptococcus sp. was isolated from the cerebrospinal fluid of patients with meningoencephalitis admitted at Hospital de Clinicas de Porto Alegre, 700-bed tertiary Brazilian reference hospital, from January 2014 to December 2015. Initially, C. neoformans and C. gattii were distinguished by a phenotypic method – CGB agar (cavanine glycine bromothymol blue agar). Detailed demographics, risk factors, treatment regimens and clinical outcome of the patients with meningeal cryptococcosis were evaluated from medical records. The study was approved by the local ethics committee. Cryptococcus complex reference strains were very kindly provided by Laboratory of Mycology (Pathogenic Fungi Collection), at Oswaldo Cruz Foundation (FIOCRUZ) – INI/FIOCRUZ in Brazil. The strains included were the following: WN=M 148 (VNI, serotype A), WM 626 (VNII, serotype A), WM 628 (VNIII, serotype AD), WM 629 (VNIV, serotype D), WM 179 (VGI, serotype B), WM 178 (VGII, serotype B), WM 161 (VGIII, serotype B) and WM 779 (VGIV, serotype C). The extraction of genomic DNA and RFLP analysis was performed according protocol using 2 primers: URA5 (5′ATGTCCTCCCAAGCCCTCGACTCCG3′) and SJ01 (5′ TTAAGACCTCTGAACACCGTACTC3′). RFLP patterns were assigned visually by comparing them to the patterns obtained from the standard-type strains (VNI-VNIV and VGI-VGIV).14,15

Fifteen patients with cryptococcal meningoencephalitis were evaluated in the study (Table 1). The gene URA-5 RFLP showed that nine patients had VNII, serotype A, two patients VNI serotype A, and two had VGII, serotype B isolate from their CSF samples. Two patients presented a positive CSF cryptococcal polysaccharide antigen, and Cryptococcus could not be isolated from the CSF samples. As expected, the VNII, serotype A strains were isolated from patients with underlying immunossupressive disease. HIV positive was the most common condition, followed by kidney and liver transplant. Meningoencephalitis by C. gattii was diagnosed in two patients. One of them was immunocompetent and the other presented an immunosuppressive condition (HIV). Clinical isolates were highly susceptible to amphotericin B and fluconazole by microdilution method (data not shown). In Brazil, studies of the invitro susceptibility of Cryptococcus spp. have shown that most isolates are susceptible to polyene antifungals, 5-flucytosine, and azoles.16

Table 1.

Cryptococcus species complex and genotype identification in the CSF samples from patients with cryptococcal meningitis.

  Age/Sex  Species complex  Molecular type  Underlying disease  Treatment  Outcome 
54/M  C. neoformans  VNII, Serotype A  Kidney transplant  Liposomal AmB+FCZ  Death 
6/M  C. neoformans  VNII, Serotype A  Liver transplant  AmB+5-FC  Alive 
45/M  Not available  Not available  HIV+  AmB+FCZ  Death 
27/M  C. neoformans  VNII, Serotype B  HIV+  AmB+FCZ  Alive 
65/M  C. gattii  VGII, Serotype B  Immunocompetent  AmB+FCZ (VCZ)  Death 
33/F  C. neoformans  VNII, Serotype A  Kidney transplant  AmB+FCZ  Alive 
42/M  C. neoformans  VNII, Serotype A  HIV+  AmB+FCZ  Alive 
55/M  C. neoformans  VNII, Serotype A  HIV+  AmB+FCZ  Death 
62/M  C. neoformans  VNII, Serotype A  Kidney transplant  AmB+FCZ  Alive 
10  25/F  C. neoformans  VNII, Serotype A  HIV+  AmB+FCZ  Alive 
11  38/M  C. neoformans  VNI, Serotype A  HIV+  Lipid complex AmB+FCZ  Alive 
12  44/F  C. neoformans  VNII, Serotype A  HIV+  AmB+FCZ  Alive 
13  37/F  C. neoformans  VNI, Serotype A  HIV+  AmB+FCZ  Death 
14  41/M  C. gattii  VGII, Serotype B  HIV+  AmB+FCZ  Death 
15  43/F  Not available  Not available  HIV+  AmB+FCZ  Death 

M, male; F, female; AmB, amphotericin B deoxycholate; FLZ, fluconazole; VCZ, voriconazole.

Although we analyzed a small number of isolates, our study has shown the predominance of VNII Cryptococcus genotype in patients with meningoencephalitis. Previous studies have shown that the VNI molecular pattern is the most common pattern worldwide, whereas VNII was observed in 1%–16% of cases reported in South America, Africa, and Oceania.17,2C. gattii VGII was also observed in South America, North America, and Oceania. Table 2 describes the studies evaluating the Cryptococcus genotypes circulating in Brazil.18–33 Several regions exhibited a high prevalence of the VNI molecular type and sporadic cases of the VNII and VGII molecular types in Brazil. The predominance of the VNI molecular type has been described in the States of São Paulo, Minas Gerais, Mato Grosso, Amazonas, PIauí, Rio Grande do Sul and Rio de Janeiro in Brazil.

Table 2.

Studies addressing the prevalence of Cryptococcus molecular types in cryptococcosis in Brazil.

Reference  Location – state  Predominant molecular type  Other molecular types 
Wirth et al. (present case)  Rio Grande do Sul  VNII  VNI, VGII 
Nunes et al.18  Mato Grosso do Sul  VNI  VNI, VGII 
Andrade-Silva et al.19  Minas Gerais  VNI   
Aguiar et al.20  Minas Gerais  VNI  VNI, VGI 
Ferreira-Paim et al.21  Minas Gerais  VNI   
Figueiredo et al.22  São Paulo  VNII  VGII 
Favalessa et al.23  Mato Grosso  VNI  VGII 
Freire et al.24  Amazonas  VNI  VNII, VGII 
Matos et al.25  Bahia  VNI  VGII 
da Silva et al.26  Amazonas  VNI  VGII 
Martins et al.27  Piauí  VNI  VGII 
Mora et al.28  Minas Gerais  VNI  VGII 
Souza et al.29  Goias  VNI  VGII 
Triles et al.30  RS, SP, MS, MG, BA PI, PE, RR, AM  VNI, VGII  VNII, VNIII, VNIV, VGI, VGIII 
Matsumoto et al.31  São Paulo  VNI  VNII 
Igreja et al.32  Rio de Janeiro  VNI, VNII  VGI, VGII 
Casali et al.33  Rio Grande do Sul  VNI  VGIII 

RS, Rio Grande do Sul; SP, São Paulo; MS, Mato Grosso do Sul; MG, Minas Gerais; BA, Bahia; PI, Piauí; PE, Pernambuco; RR, Roraima; AM, Amazonas.

Studies of molecular types of Cryptococcus contribute to the evaluation of the epidemiology, clinical manifestations, interventions and therapeutic approach for cryptococcosis. The presence of molecular type VNII was reported in all five continents, but little is known about its pathobiology, ecology, and antifungal susceptibility. Therefore, tools that are able to identify it are important to better understand how it is distributed in the environment, how it interacts with the host, and finally if it needs a different and more specific treatment to improve the patient outcome. Additional studies of VNII isolates will contribute to understanding the epidemiology and phylogenetic relationship of this genotype compared to the other ones, revealing if it represents a separate species in the C. neoformans species complex.

Conflicts of interest

The authors declare no conflicts of interest.

Acknowledgments

The study was supported in part by CNPq (Brazilian National Council of Research).

References
[1]
K.J. Kwon-Chung, J.E. Bennett, B.L. Wickes, et al.
The case for adopting the “species complex” nomenclature for the etiologic agents of cryptococcosis.
mSphere, 2 (2017), pp. e00357-e416
[2]
W. Meyer, A. Castañeda, S. Jackson, M. Huynh, E. Castañeda.
IberoAmerican Cryptococcal Study Group Molecular typing of IberoAmerican Cryptococcus neoformans isolates.
Emerg Infect Dis, 9 (2003), pp. 189-195
[3]
M. Van Wyk, N.P. Govender, T.G. Mitchell, A.P. Litvintseva.
Multilocus sequence typing of serially collected isolates of Cryptococcus from HIV-infected patients in South Africa.
J Clin Microbiol, 52 (2014), pp. 1921-1931
[4]
K.J. Kwon-Chung.
A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans.
Mycologia, 67 (1975), pp. 1197-1200
[5]
K.J. Kwon-Chung.
A new genus, Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes.
Mycologia, 68 (1976), pp. 942-946
[6]
S.P. Franzot, I.F. Salkin.
Casadevall A Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates.
J Clin Microbiol, 37 (1999), pp. 838-840
[7]
E.K. Maziarz, J.R. Perfect.
Cryptococcosis.
Infect Dis Clin North Am, 30 (2016), pp. 179-206
[8]
S.P. Franzot, J.S. Hamdan, B.P. Currie, A. Casadevall.
Molecular epidemiology of Cryptococcus neoformans in Brazil and the United States: evidence for both local genetic differences and a global clonal population structure.
J Clin Microbiol, 35 (1997), pp. 2243-2251
[9]
B.P. Currie, L.F. Freundlich, A. Casadevall.
Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and clinical sources in New York City.
J Clin Microbiol, 32 (1994), pp. 1188-1192
[10]
J.R. Perfect, N. Ketabchi, G.M. Cox, C.W. Ingram, C.L. Beiser.
Karyotyping of Cryptococcus neoformans as an epidemiological tool.
J Clin Microbiol, 31 (1993), pp. 3305-3309
[11]
A. Varma, D. Swinne, F. Staib, J.E. Bennet, K.J. Kwon-Chung.
Diversity of DNA fingerprints in Cryptococcus neoformans.
J Clin Microbiol, (1995), pp. 1807-1814
[12]
S.C. Chen, A.G. Brownlee, T.C. Sorrel, et al.
Identification by random amplification of polymorphic DNA of a common molecular type of Cryptococcus neoformans var neoformans in patients with AIDS or other immunosuppressive conditions.
J Infect Dis, (1996), pp. 754-758
[13]
D. Ellis, D. Marriott, R.A. Hajjeh, D. Warnock, W. Meyer, R. Barton.
Epidemiology: surveillance of fungal infections.
Med Mycol, (2000), pp. 173-182
[14]
W. Meyer, S. Kidd, A. Castañeda, et al.
Global molecular epidemiology offers hints towards ongoing speciation within Cryptococcus neoformans.
Abstracts of the 5th international conference on Cryptococcus and Cryptococcosis,
[15]
T. Boekhout, B. Theelen, M. Diaz, et al.
Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans.
Microbiology, 147 (2001), pp. 891-907
[16]
P.F. Herkert, Meis F F, G. Lucca de Oliveira Salvador, et al.
Molecular characterization and antifungal susceptibility testing of Cryptococcus neoformans sensu stricto from southern Brazil.
[17]
M. Cogliati.
Global molecular epidemiology of Cryptococcus neoformans and Cryptococcus gattii: an atlas of the molecular types.
Scientifica, 2013 (2013), pp. 1-23
[18]
J.O. Nunes, R.A.S. Tsujisaki, M.O. Nunes, et al.
Cryptococcal meningitis epidemiology: 17 years of experience in a State of the Brazilian Pantanal.
Rev Soc Bras Med Trop, 51 (2018), pp. 485-492
[19]
L.E. Andrade-Silva, K. Ferreira-Paim, T.B. Ferreira, et al.
Genotypic analysis of clinical and environmental Cryptococcus neoformans isolates from Brazil reveals the presence of VNB isolates and a correlation with biological factors.
PLoS One, 13 (2018), pp. e0193237
[20]
P.A.D.F. Aguiar, R.D.S. Pedroso, A.S. Borges, T.A. Moreira, L.B. Araújo, D.V.D.B. Röder.
The epidemiology of cryptococcosis and the characterization of Cryptococcus neoformans isolated in a Brazilian University Hospital.
Rev Inst Med Trop Sao Paulo, 59 (2017), pp. e13
[21]
K. Ferreira-Paim, L. Andrade-Silva, F.M. Fonseca, et al.
MLST-based population genetic analysis in a global context reveals clonality amongst Cryptococcus neoformans var. grubii VNI isolates from HIV patients in Southeastern Brazil.
PLoS Negl Trop Dis, 11 (2017), pp. e0005223
[22]
T.P. Figueiredo, R.C. Lucas, R.A. Cazzaniga, et al.
Antifungal susceptibility testing and genotyping characterization of Cryptococcus neoformans and gattii isolates from HIV-infected patients of Ribeirão Preto, São Paulo, Brazil.
Rev Inst Med Trop Sao Paulo, 58 (2016), pp. 69
[23]
O.C. Favalessa, D.A.J. de Paula, V. Dutra, et al.
Molecular typing and in vitro antifungal susceptibility of Cryptococcus spp from patients in Midwest Brazil.
J Infect Dev Ctries, 8 (2014), pp. 1037-1043
[24]
A.K. Freire, A. dos Santos Bentes, I. de Lima Sampaio, et al.
Molecular characterisation of the causative agents of Cryptococcosis in patients of a tertiary healthcare facility in the state of Amazonas-Brazil.
[25]
C.S. Matos, A. de Souza Andrade, N.S. Oliveira, T.F. Barros.
Microbiological characteristics of clinical isolates of Cryptococcus spp. in Bahia Brazil: molecular types and antifungal susceptibilities.
Eur J Clin Microbiol Infect Dis, 31 (2012), pp. 1647-1652
[26]
B.K. Da Silva, A.K. Freire, S. Bentes Ados, et al.
Characterization of clinical isolates of the Cryptococcus neoformans–Cryptococcus gattii species complex from the Amazonas State in Brazil.
Rev Iberoam Micol, 29 (2012), pp. 40-43
[27]
L.M.S. Martins, B. Wanke, M.S. Lazéra, et al.
Genotypes of Cryptococcus neoformans and Cryptococcus gattii as agents of endemic cryptococcosis in Teresina Piauí (northeastern Brazil).
Mem Inst Oswaldo Cruz, 106 (2011), pp. 725-730
[28]
D.J. Mora, A.L. Pedrosa, V. Rodrigues, et al.
Genotype and mating type distribution within clinical Cryptococcus neoformans and Cryptococcus gattii isolates from patients with cryptococcal meningitis in Uberaba, Minas Gerais, Brazil.
Med Mycol, 48 (2010), pp. 561-569
[29]
L.K. Souza, A.H. Souza Junior, C.R. Costa, et al.
Molecular typing and antifungal susceptibility of clinical and environmental Cryptococcus neoformans species complex isolates in Goiania, Brazil.
Mycoses, 53 (2010), pp. 62-67
[30]
L. Trilles, M.S. Lazéra, B. Wanke, et al.
Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil.
Mem Inst Oswaldo Cruz, 103 (2008), pp. 455-462
[31]
M.T. Matsumoto, A.M. Fusco-Almeida, L.C. Baeza, M.S.C. Melhem, M.J.S. Mendes-Giannini.
Genotyping, serotyping and determination of mating-type of Cryptococcus neoformans clinical isolates from São Paulo, state Brazil.
Rev Inst Med Trop Sao Paulo, 49 (2007), pp. 41-47
[32]
R.P. Igreja, M. Lazéra, S. dos, et al.
Molecular epidemiology of Cryptococcus neoformans isolates from AIDS patients of the Brazilian city, Rio de Janeiro.
Med Mycol, 42 (2004), pp. 229-238
[33]
A.K. Casali, L. Goulart, L.K.R. Silva, et al.
Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul.
FEMS Yeast Res, 3 (2003), pp. 405-415
Copyright © 2019. Sociedade Brasileira de Infectologia
The Brazilian Journal of Infectious Diseases

Subscribe to our newsletter

Article options
Tools
Cookies policy
To improve our services and products, we use cookies (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here.